ID: 1068916571

View in Genome Browser
Species Human (GRCh38)
Location 10:62438825-62438847
Sequence TGTGAGAAGCATACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068916571_1068916575 29 Left 1068916571 10:62438825-62438847 CCTTCCTCAGTATGCTTCTCACA No data
Right 1068916575 10:62438877-62438899 TCAAGCAGAAAGAATTTGCCTGG No data
1068916571_1068916574 4 Left 1068916571 10:62438825-62438847 CCTTCCTCAGTATGCTTCTCACA No data
Right 1068916574 10:62438852-62438874 TTAGAAAGCTTTATTAAGGTAGG No data
1068916571_1068916573 0 Left 1068916571 10:62438825-62438847 CCTTCCTCAGTATGCTTCTCACA No data
Right 1068916573 10:62438848-62438870 GTACTTAGAAAGCTTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068916571 Original CRISPR TGTGAGAAGCATACTGAGGA AGG (reversed) Intronic
No off target data available for this crispr