ID: 1068918385

View in Genome Browser
Species Human (GRCh38)
Location 10:62457973-62457995
Sequence ATGTCTCCCTGGGAGAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068918385_1068918391 10 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918391 10:62458006-62458028 TAATAGATCAGATCTTGGGGAGG No data
1068918385_1068918388 5 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918388 10:62458001-62458023 TTTCTTAATAGATCAGATCTTGG No data
1068918385_1068918392 11 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918392 10:62458007-62458029 AATAGATCAGATCTTGGGGAGGG No data
1068918385_1068918393 12 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918393 10:62458008-62458030 ATAGATCAGATCTTGGGGAGGGG No data
1068918385_1068918394 19 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918394 10:62458015-62458037 AGATCTTGGGGAGGGGACGAAGG No data
1068918385_1068918389 6 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918389 10:62458002-62458024 TTCTTAATAGATCAGATCTTGGG No data
1068918385_1068918390 7 Left 1068918385 10:62457973-62457995 CCTTAGCTCTCCCAGGGAGACAT 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1068918390 10:62458003-62458025 TCTTAATAGATCAGATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068918385 Original CRISPR ATGTCTCCCTGGGAGAGCTA AGG (reversed) Intronic
900812820 1:4820958-4820980 AGGTGTGCTTGGGAGAGCTATGG - Intergenic
902952404 1:19896451-19896473 TTGTCTCCCAGGAAGAGCAATGG - Intronic
903586455 1:24419323-24419345 CTGTCTGCCTGGGAGAGCCACGG + Exonic
904824608 1:33266177-33266199 TTAACTCCCTGGGAGAGCAAAGG - Intronic
905180472 1:36162368-36162390 AAGTCTCCCTGGGGGAACCACGG + Intronic
906060929 1:42948159-42948181 ATGGCTTCCTGGGAGAGGGAGGG - Intronic
910972903 1:92874350-92874372 AGGTCTTCCTGGGAGGGCTGTGG + Intronic
913153842 1:116074520-116074542 ATGTCTCAGTGGGAGACCTCAGG - Intergenic
919019044 1:192079902-192079924 GAGTTTCCTTGGGAGAGCTAAGG - Intergenic
920103201 1:203531246-203531268 CTGTCTCCCTGGGCTAGCTCTGG - Intergenic
920460876 1:206139216-206139238 CTGTCTCCCTGGGAGGGCTTGGG - Intergenic
921491569 1:215782875-215782897 ATTTCTGCCTGGAACAGCTATGG - Exonic
923546290 1:234925898-234925920 ATGTCTCAGTGGAAGAACTATGG + Intergenic
924167895 1:241304327-241304349 ATGGCTACCTGGGAGAGCCATGG + Intronic
1064183399 10:13139357-13139379 ATGTTACCCTGGGAGACATAAGG + Intergenic
1066330349 10:34414906-34414928 ATGAGTCCCTGGAAGAGTTATGG - Intronic
1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG + Intergenic
1068048684 10:51920245-51920267 ATATCTCCCTGGGATGGATAGGG - Intronic
1068136586 10:52955342-52955364 CTGTCTCCCTGGGAGGGAAATGG - Intergenic
1068918385 10:62457973-62457995 ATGTCTCCCTGGGAGAGCTAAGG - Intronic
1069801566 10:71084973-71084995 CTGAATCCCTGGCAGAGCTAAGG + Intergenic
1072627472 10:97122382-97122404 CTGTTTCCCTTGGAGAGCTGGGG - Intronic
1073054384 10:100689625-100689647 ATTTCTTCCTGGGAGTGCTTAGG + Intergenic
1073328438 10:102656150-102656172 ATGTGCCCCCGGGAGGGCTAGGG - Intronic
1073686393 10:105759122-105759144 ATGTCTACCAGGGAGAGGGAGGG - Intergenic
1074670898 10:115789547-115789569 ATAGTTGCCTGGGAGAGCTAAGG + Intronic
1079486120 11:20937601-20937623 AGGTCTGCCTGGGAGATTTAAGG + Intronic
1083925184 11:65801733-65801755 ACCTCTGCCTGGGAGAGCTGGGG - Intergenic
1084981783 11:72832854-72832876 CTGTCTTCCTGGGAGATCTTGGG + Intronic
1085623705 11:78056248-78056270 ATGTCTCCCTGGCAGACAGAAGG - Intronic
1091541965 12:1470146-1470168 ATGGCTCCCACAGAGAGCTATGG - Intronic
1091691323 12:2599340-2599362 ATGTCCCCCTTGGACAGCCACGG - Intronic
1097349858 12:58536764-58536786 CTGCCTCCCTGAGAGAGCCAAGG + Intergenic
1101368537 12:104101058-104101080 CTGTCTAACTGGGAGAGTTAGGG + Intronic
1102220381 12:111190427-111190449 ATGTCTCCCTGAGAAAGGTCAGG - Intronic
1103028373 12:117592530-117592552 ATTTCTCACTGGGAGAGGGAGGG - Intronic
1103560203 12:121789636-121789658 CTGTCTCCCTGGGAAAGCACAGG - Intronic
1105250011 13:18690160-18690182 ATTTCTCCCTGGGAAAACCAGGG + Intergenic
1106414569 13:29535862-29535884 ATGTCACCGTTGGAGAGCTCTGG - Exonic
1108021939 13:46136484-46136506 CTGTCTCCCAGGGAAAGCAAGGG + Intronic
1108944059 13:55999571-55999593 ATGGCTCCCTGGGGGAGGTTTGG - Intergenic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1113941643 13:114021448-114021470 ATGAATTCCTGGGAGAACTAAGG - Exonic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1114521870 14:23344564-23344586 ATGTCACCCAGGCAGTGCTATGG + Intergenic
1114628164 14:24142753-24142775 AGGTTTCACTGGGAGAACTATGG - Intergenic
1116016867 14:39417846-39417868 ATGTTTCTATGGGAGAGCAAAGG + Intronic
1117286680 14:54292053-54292075 ATTTCTCCCTGGCAGATCAAAGG + Intergenic
1117307720 14:54492862-54492884 AGGGCTCTCTTGGAGAGCTAAGG - Intergenic
1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG + Intergenic
1118861395 14:69667017-69667039 ATGTCTCCTTGGGAGAGGGCGGG + Intronic
1119617608 14:76109153-76109175 AGCTCTCCTTGGGAGAGCTCTGG + Intergenic
1120076882 14:80168980-80169002 ATCTCTGCCTGGGGGAGTTAGGG - Intergenic
1120857590 14:89226153-89226175 ATGTCTCCTTGGTAGATCAATGG - Intronic
1121127318 14:91416897-91416919 GTCTCTGCCTGGGAGAGCTTTGG - Intronic
1121258198 14:92546845-92546867 AGGTGTCCCTGGGAGAGATAGGG + Intronic
1122943637 14:104994939-104994961 ATGTGTCCTTGGCAGAGCCAAGG + Exonic
1124402011 15:29356888-29356910 AAGTCTCCATGGTAGAGCAAAGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126731467 15:51687511-51687533 ATGTATTCCTAGGAGAGCCAAGG + Intronic
1126833795 15:52637776-52637798 ATGTCTGCCTGAGAGAGTAAGGG - Intronic
1128669771 15:69566377-69566399 CTGTCTTCCTTGGGGAGCTATGG + Intergenic
1128733302 15:70035114-70035136 ATGGCTTCCTGGAAGAGGTAAGG - Intergenic
1130537331 15:84796779-84796801 ATGTCTTCCTGGTGGAACTATGG - Intronic
1132209379 15:100008657-100008679 AAGTCTCCCTGGGACAGGAAGGG - Intronic
1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG + Intronic
1136093083 16:27934647-27934669 ATGGCACCATGGGAGAGCTGTGG + Intronic
1136274692 16:29172114-29172136 CTGTCTCCCTGGGCTAGCCATGG - Intergenic
1140602785 16:76498673-76498695 CTGTCTCCCTGGCAGAGCAGAGG - Exonic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1141508070 16:84492980-84493002 ATGTCTCCCTTGGAGCTCAAGGG - Intronic
1142078986 16:88137872-88137894 CTGTCTCCCTGGGCTAGCCATGG - Intergenic
1142135408 16:88449739-88449761 CAGTCTCCCGGGGAGAGCTCAGG - Intergenic
1146931325 17:36780194-36780216 CTCTCTCCCTGGGGGAGCTGTGG - Intergenic
1147388151 17:40093665-40093687 ATTTCTGCCTGGGGGAGCTGGGG - Exonic
1147636764 17:41968684-41968706 AGGTCTTCCTGGAAGAGCTGGGG + Exonic
1148984254 17:51607905-51607927 ATTTCTCCCTTAGAGAGCTAAGG - Intergenic
1152558491 17:81066477-81066499 ATGCCCACCTGGGAGAGCTGGGG + Intronic
1157669598 18:49517242-49517264 AAGTGTCCATGGGAGAGCTACGG + Intergenic
1157980601 18:52375565-52375587 ATGTCTCCGTGGACCAGCTATGG + Intronic
1161222398 19:3123635-3123657 ATGCCTCCCTGGGGGAGCCGGGG - Exonic
1165380543 19:35476437-35476459 ATCTTTCCATGGGAGAGCCATGG + Intergenic
1165810517 19:38609091-38609113 AGGTCTCCCTGGGAACTCTATGG + Intronic
1166144615 19:40825368-40825390 TTCTTTCCCTGGGAGAGCTGGGG + Intronic
1166183128 19:41122693-41122715 TTCTTTCCCTGGGAGAGCTGGGG - Intronic
1167303471 19:48693713-48693735 CTGTCCCCCTGGGGGAGTTATGG + Intergenic
1167446550 19:49541274-49541296 GTGTCTGCCTGGTAGAGCTGAGG - Intronic
1168494250 19:56837118-56837140 AGGACTCCGTAGGAGAGCTAGGG + Intronic
926314976 2:11702922-11702944 CTGTCTCCCTGGGGAAGATAAGG - Intronic
927060816 2:19417497-19417519 ATCTTCACCTGGGAGAGCTACGG + Intergenic
927458134 2:23275146-23275168 ATGCCTCCCTGGGTAAACTAAGG + Intergenic
928621391 2:33091812-33091834 AAGTTTCCCTGGAAGAGCTCAGG - Intronic
928742022 2:34366028-34366050 ATCTCTGCCTTGTAGAGCTATGG + Intergenic
929580009 2:43076077-43076099 ATGTCTCCCTGGGAGGGGACTGG + Intergenic
929992046 2:46798458-46798480 ATGTGTCCCTAGGTGAACTAAGG - Intergenic
930010709 2:46936343-46936365 ATTTGTCCCTGGGCCAGCTAAGG - Intronic
931779646 2:65567932-65567954 ATGTCACCATGTGAGAGCTGTGG - Intergenic
932113643 2:69024724-69024746 AGGTCAACCTGGGAGAGATATGG - Intronic
933891419 2:86774923-86774945 ATGTTTACCTGGGAGAGCTGGGG + Exonic
935978833 2:108606730-108606752 CTGCCTCCCTGGGGGAGCTCTGG + Intronic
936281757 2:111147397-111147419 ATTTCTCCCTGCCAGAGCTTAGG + Intronic
937487453 2:122330289-122330311 ATGTTTCCTTGGGACAGCTTTGG - Intergenic
939229180 2:139405004-139405026 AGGTCTCCCTGGGGGATCCAGGG + Intergenic
942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG + Intergenic
943771361 2:191721286-191721308 ATCTCTGCCTGGGGGAGGTAGGG - Intergenic
945028348 2:205640837-205640859 ATATCTCTGTGGGTGAGCTAAGG + Intergenic
946300732 2:218822602-218822624 ATGGCTCACTGCGAGAGCTAAGG + Exonic
946363777 2:219235997-219236019 TTGTCTCCCTCAGAGAGCTCTGG + Exonic
947394896 2:229676680-229676702 ATGTCTCCCAAGGAGAACTCTGG + Intronic
1171032958 20:21693303-21693325 ACGTCTCCCTGGGAAAGCAAAGG - Intergenic
1172027630 20:31959928-31959950 AAGTCCCTCTGGGAGAGCTGAGG - Intergenic
1172486864 20:35303712-35303734 AGGACACCCCGGGAGAGCTAGGG + Exonic
1174162205 20:48559423-48559445 GTGTCTGCCTGGGAGACTTAGGG - Intergenic
1176456866 21:6920696-6920718 ATTTCTCCCTGGGAAAACCAGGG + Intergenic
1176835039 21:13785756-13785778 ATTTCTCCCTGGGAAAACCAGGG + Intergenic
1179438305 21:41376881-41376903 CTGTCTCCCTGTCAGAGCTGGGG - Exonic
951284164 3:20788914-20788936 TTGTCTCCCTGGGAGATATTTGG - Intergenic
953272244 3:41457178-41457200 ATTTCTTCCTGGGAGAGATAAGG + Intronic
953594241 3:44293408-44293430 TTGTCTCCCTGGAAGGTCTATGG - Intronic
954974422 3:54679461-54679483 ATCAATCCCTGGGAGAGCTGGGG + Intronic
956785476 3:72638701-72638723 ATTTCCCCCTAGGAGATCTAAGG - Intergenic
957165674 3:76669677-76669699 CTGTGTCCCAGGGAGAACTATGG - Intronic
957216485 3:77326824-77326846 AAGTCTCCCTGGTGGAGCTGTGG + Intronic
960001345 3:112735159-112735181 ATCCCTCCCTGAGAGAGCAATGG + Intergenic
960324522 3:116279149-116279171 ATGTGTCCCTGGGAAAGAGAGGG + Intronic
961728048 3:128945684-128945706 CTGTCTCTCTGGGAGAGATGAGG + Exonic
962829656 3:139128877-139128899 ATCTCTGCCTGGGAGAGCTGGGG + Intronic
962992061 3:140586865-140586887 ACATCTCCTGGGGAGAGCTAAGG + Intergenic
963016358 3:140827991-140828013 ATGTCTGCCTTGTAGAGCTGTGG + Intergenic
963095864 3:141539350-141539372 AAGTCTGCCTGAGAAAGCTAAGG - Intronic
964689021 3:159429350-159429372 ATCTCTCTGTGGGAGAGATAAGG - Intronic
967295514 3:187960508-187960530 ATTTCTCCTTGTGAGATCTATGG - Intergenic
968582219 4:1400456-1400478 CAGTCTCCCTGGGAGAGTTGGGG - Intergenic
969239833 4:5890823-5890845 AACTCTCCTTGGGACAGCTACGG + Intronic
971366075 4:25978092-25978114 CTGTCTCCCTGGGGGTGCTGGGG + Intergenic
971503262 4:27339522-27339544 ATACCTCCTTTGGAGAGCTATGG - Intergenic
971537728 4:27774907-27774929 ATGTCTCGCTGGGTAAGCTCAGG + Intergenic
975283706 4:72593001-72593023 AATTCTGCCTTGGAGAGCTAAGG - Intergenic
976847814 4:89510481-89510503 ATACCTGCCTGGAAGAGCTAGGG + Intergenic
982140809 4:152316042-152316064 ACAGATCCCTGGGAGAGCTAGGG + Intergenic
995297435 5:110537854-110537876 ATCTCTCCATGAGAGAGCAACGG - Intronic
1002130759 5:177080088-177080110 ATGACAGCCTGGGAGAGCTCTGG - Intronic
1003503939 6:6724872-6724894 GTGTCTCCCTGGCACAGCTTTGG - Intergenic
1003512222 6:6791098-6791120 ATGTCACCCTGTGAGTCCTACGG + Intergenic
1004046441 6:12028570-12028592 ATATCTTCTTGGAAGAGCTAGGG + Intronic
1005608166 6:27496265-27496287 ATGTCTCACTTGGAGAAGTAGGG + Intergenic
1006835266 6:36994956-36994978 ATTTCTCCTGGGGAGAGCAAAGG + Intergenic
1010260619 6:73811846-73811868 TTGTGTTCCTGGGAGAGCCAGGG + Intronic
1012493500 6:99809124-99809146 CTTTCTTCCTGGTAGAGCTATGG + Intergenic
1015298268 6:131624172-131624194 ATTTCTCCCAAGGAGAGGTAGGG + Intronic
1019444097 7:1061944-1061966 ATGGCTGCCTGGAAGAACTAGGG - Intronic
1019576361 7:1739563-1739585 AAGACCCCCTGGGAGAGCTGGGG + Intronic
1020088173 7:5322791-5322813 ATGGCTCGCTGGGAGAGGGATGG + Intronic
1020639766 7:10741162-10741184 AAGTCTCCTTGGCAAAGCTATGG + Intergenic
1021972681 7:25981120-25981142 ATCTCTTCCTGAGAGAGGTAAGG + Intergenic
1023640264 7:42250465-42250487 ATGACTCCCTGTGACAGCTGTGG - Intergenic
1023832752 7:44049512-44049534 ATGTCACCCATGGAGAGATAAGG + Intronic
1024562422 7:50655734-50655756 ATCTCTTCCTGGGACACCTAAGG + Intronic
1025158382 7:56630725-56630747 ACGTCTCCCTGGGTTGGCTAGGG + Intergenic
1025206139 7:56994334-56994356 ATGACTCGCTGGGAGAGGGATGG - Intergenic
1025665802 7:63582605-63582627 ATGACTCGCTGGGAGAGGGATGG + Intergenic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1030968463 7:116023754-116023776 ATTTTTCCCTGGGAGTGCTGTGG - Intronic
1031862936 7:127003048-127003070 AAGTGTCCCTGGCAGAGCAATGG - Intronic
1032534085 7:132646216-132646238 TTTTTTCCCTGGAAGAGCTACGG + Intronic
1033024355 7:137758228-137758250 ATGAGCCCCTGGGTGAGCTATGG + Intronic
1033788299 7:144760657-144760679 ATCTCTACCTGGGGAAGCTAAGG + Intronic
1034556429 7:151853087-151853109 CTGTGTCCCTCGGAGAGCTCGGG + Intronic
1034909764 7:154986116-154986138 AGCTCTCCCAGGGAGAGGTAGGG - Intronic
1034909766 7:154986120-154986142 ACCTCTCCCTGGGAGAGCTCTGG + Intronic
1035216977 7:157375029-157375051 ATCTCCCCCTGGGAGCACTAAGG - Intronic
1035435005 7:158853118-158853140 ATGTCACCCTGGCAATGCTATGG + Intergenic
1036771170 8:11579203-11579225 CTGTCTCCCTGGGACAGCTTTGG + Intergenic
1038324766 8:26564493-26564515 ACGTCTTCCTGTGAGACCTAGGG + Intronic
1040372833 8:46794373-46794395 ATGTCTCCCCGGGTAGGCTAGGG - Intergenic
1041496027 8:58486271-58486293 AGGTGTCCCTGGGAGTGCTTTGG - Intergenic
1043005269 8:74810617-74810639 ATGTGGCCCTGTGACAGCTATGG - Intronic
1044251377 8:90007052-90007074 AATTCTCCCTGGGAGTGTTAGGG + Intronic
1045383165 8:101646844-101646866 CTGGCTCCCTGGGAAAGCTGTGG + Intronic
1046658104 8:116918720-116918742 ATGTCTCTCTAGGAAAACTAAGG + Intergenic
1047793896 8:128234330-128234352 ATATCTATCTGGCAGAGCTATGG + Intergenic
1049093456 8:140534196-140534218 CTGTCTCCATGGGACTGCTAAGG + Intronic
1052104426 9:24495068-24495090 ATGTTTTACTGGGAGAGTTAGGG - Intergenic
1056577811 9:87869319-87869341 ATGCCCCCCAGGGAGAGCCATGG + Intergenic
1056579041 9:87876997-87877019 ATGTCTTCCTAAGAGAGCTCTGG + Intergenic
1056827076 9:89883870-89883892 ATGGCTTCCAGGGAGAGCTGAGG - Intergenic
1058500809 9:105613880-105613902 ATGTCTTCCTGGGAAAACTGGGG + Intronic
1059285087 9:113165664-113165686 AGGTCTCCCTGGTAGAACTAAGG - Exonic
1061410696 9:130419733-130419755 ATGTCTGCCAGGGACAGCGAGGG - Intronic
1189785198 X:44553100-44553122 ATGTCTACCTGTGAGAGAAAAGG - Intergenic
1192142096 X:68654572-68654594 ATGTGTGCCTGGGCGAGCTCAGG - Intronic
1195480193 X:105335908-105335930 ATGTCTCCAGAGGAAAGCTAAGG - Intronic
1198052977 X:132966621-132966643 ATGTGTGCTTGGGGGAGCTAAGG - Intergenic
1198982821 X:142418837-142418859 ATGCCACCCTGGCAGTGCTATGG + Intergenic
1199540349 X:148951984-148952006 ATGTCTACCTGGGAGATTAAAGG + Intronic
1200860245 Y:7983689-7983711 ATGTCTCCCTGGGTTGGCTAGGG + Intergenic