ID: 1068923543

View in Genome Browser
Species Human (GRCh38)
Location 10:62511253-62511275
Sequence CTGAATGTTGAAATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068923541_1068923543 -9 Left 1068923541 10:62511239-62511261 CCAGTGTGAGTTTTCTGAATGTT 0: 1
1: 0
2: 4
3: 28
4: 510
Right 1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG No data
1068923540_1068923543 2 Left 1068923540 10:62511228-62511250 CCTGTTATCTTCCAGTGTGAGTT No data
Right 1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG No data
1068923539_1068923543 3 Left 1068923539 10:62511227-62511249 CCCTGTTATCTTCCAGTGTGAGT 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068923543 Original CRISPR CTGAATGTTGAAATGGAGAA AGG Intronic
No off target data available for this crispr