ID: 1068931442

View in Genome Browser
Species Human (GRCh38)
Location 10:62594456-62594478
Sequence TGGGAATAGGCAGATGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931442_1068931453 17 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931453 10:62594496-62594518 TGGCTCTCGGCTGATGCTCTGGG No data
1068931442_1068931450 4 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931450 10:62594483-62594505 CTAGCAGGGTGCCTGGCTCTCGG No data
1068931442_1068931452 16 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931442_1068931445 -10 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931445 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG No data
1068931442_1068931454 24 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931454 10:62594503-62594525 CGGCTGATGCTCTGGGTCTGTGG No data
1068931442_1068931448 -3 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931448 10:62594476-62594498 CCACTACCTAGCAGGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931442 Original CRISPR TGGGAATAGGCAGATGAGTA CGG (reversed) Intronic
904544512 1:31258183-31258205 TGGGACTTGGAGGATGAGTAGGG - Intergenic
904999811 1:34659359-34659381 TGGAAAGAGACAGATGAGGAAGG - Intergenic
905024588 1:34840941-34840963 TGGGAATATGCAGCTGAGGTTGG + Intronic
905595810 1:39205584-39205606 TGAGAAAAGGCAGAGGAGGAAGG + Intronic
907394708 1:54181158-54181180 TGGGAGGAGGCAGAGGAGCATGG - Intronic
909736283 1:78966612-78966634 TTGGAATGGACAGATGAGCAGGG + Intronic
911548317 1:99248011-99248033 TGCCAATAAGCAGATGAGAAAGG - Intergenic
912864763 1:113247366-113247388 GGGGAAGAGGCAGAGGAGCAAGG - Intergenic
913165809 1:116183424-116183446 TGGGGAGAGGCAAAAGAGTAAGG - Intergenic
913203871 1:116517673-116517695 TGGGAAGAGGCAGAGGAGGCGGG - Intronic
915003215 1:152612748-152612770 GGGGAATATGCAGAGGAATAGGG + Intergenic
916652439 1:166844405-166844427 TGGGAATTGGGAAAGGAGTAGGG + Intronic
917240405 1:172941720-172941742 TGGGAATGGCTAGAAGAGTATGG + Intergenic
917966824 1:180184034-180184056 TGGAAATTGGCAGATCGGTAAGG + Exonic
918103147 1:181393979-181394001 TGGGGATAGGAAGAAAAGTAGGG + Intergenic
919667410 1:200305221-200305243 GGGGAATAGGCAAATGAAAAGGG + Intergenic
920618703 1:207522495-207522517 TGGGAATGGGCAGCTGAATCAGG - Intronic
921225539 1:213015603-213015625 TGGGAAGAGGCCGGTCAGTAGGG - Exonic
921593611 1:217031328-217031350 TGGGAATATGAAGATTGGTAGGG - Intronic
922669834 1:227501005-227501027 TGGGAAGTGGCAGATGATGATGG + Intergenic
923160138 1:231308185-231308207 TGGGTATGGGCAGGTGGGTAAGG - Intergenic
924022595 1:239800114-239800136 TGGAAATAGGCAGGTGTGTGGGG + Intronic
924502622 1:244651804-244651826 TGGAAATAGGGAGATGAGTGTGG - Intergenic
1063953448 10:11245029-11245051 TGGGAAGAGGAGGATGAGAAGGG - Intronic
1064023582 10:11828778-11828800 TGGGAATACGGAGGTGACTAAGG + Intronic
1064571470 10:16698024-16698046 TGGGAAGAGGGAGAAGAGGAGGG + Intronic
1064572931 10:16714578-16714600 AGGGAACAGGCAGATCTGTACGG - Intronic
1067816055 10:49477579-49477601 TGGGCATCGGAAGGTGAGTAGGG - Intronic
1068931442 10:62594456-62594478 TGGGAATAGGCAGATGAGTACGG - Intronic
1069780748 10:70953873-70953895 TGGGAAAATGAAGATGAGCAGGG + Intergenic
1071421917 10:85509033-85509055 TGTGAATAGACAAATGAGCATGG + Intergenic
1072646150 10:97256123-97256145 TAGGAATAGGAGGCTGAGTAGGG - Intronic
1073531833 10:104239362-104239384 TTGAAATAGGCAGATCAGTCGGG + Intronic
1073887075 10:108051505-108051527 AGGCAAAAGGCAGATGAGTGTGG - Intergenic
1076290890 10:129344513-129344535 TGAGAATAGGCAGACCAGGAAGG - Intergenic
1076869641 10:133187065-133187087 TCAGAATAGGAAGATGAGGAGGG - Intronic
1077462658 11:2718353-2718375 TGGAAACAGGCAGGTGAGGAGGG - Intronic
1077543193 11:3157305-3157327 TGGGAAGGGGCAGATAAGGAAGG + Intronic
1077640227 11:3874726-3874748 CGGGAATAGTCAGATGAGGGAGG - Intronic
1078754899 11:14199935-14199957 TTGGAATAGGCTGATGAACAGGG - Intronic
1079164363 11:18025089-18025111 TGGAAATACAAAGATGAGTAAGG - Intronic
1080332260 11:31153229-31153251 GGAGAAGAGGCAGATGAGGAGGG - Intronic
1081686764 11:45048469-45048491 TGGGAGGAGGCAGATAAGGAAGG + Intergenic
1082781121 11:57288159-57288181 TGGGGATGCGGAGATGAGTAAGG - Intergenic
1082819883 11:57537675-57537697 TGAGAATTGGCAGATGGGGAGGG - Intergenic
1083161628 11:60857959-60857981 TGAGAAGGGGCAGATGAGTAAGG - Intergenic
1083396827 11:62398286-62398308 TGGGAAGAGGCCGCTGAGGAAGG - Intergenic
1084157218 11:67320564-67320586 AGCGAATGGGCAGATGATTATGG + Intronic
1084318018 11:68356674-68356696 TTGGTTTAGACAGATGAGTAAGG + Intronic
1084727649 11:70952403-70952425 TGGGAATTGGCAAAGGACTACGG - Intronic
1084915516 11:72426201-72426223 TGGGAGAAGGGAGATGGGTAGGG + Intronic
1085210840 11:74776851-74776873 TAGGAATAGGGAGATGTGTAAGG + Intronic
1087812231 11:102620905-102620927 AGGGCATAGGCAGATGAATATGG + Intronic
1088130314 11:106480902-106480924 TGGGAATAGGCATATGAGTTAGG + Intergenic
1088687209 11:112295002-112295024 AGAGAATAGGCAGAAGAGGAAGG - Intergenic
1088975947 11:114816583-114816605 TGAAAATAGGGAAATGAGTAAGG - Intergenic
1089443939 11:118536702-118536724 TGGGAAGAAGCAGCTGAGTGAGG - Intronic
1089457433 11:118633780-118633802 TGGGGATGGGTAGATGAGTTGGG + Intronic
1089494213 11:118900235-118900257 TGGGGAGGGGCAGATGAGTTTGG + Intronic
1090098135 11:123764293-123764315 TGTGAACATGCAGATGAGTTTGG - Intergenic
1090193707 11:124797737-124797759 TGGGAATGTGCTGATGAGTATGG - Intronic
1091739048 12:2946865-2946887 TGGGAGTAGGAAGATTAGGAAGG + Intergenic
1093239577 12:16653425-16653447 TGGGAAGAGGCAGAGGATCAGGG - Intergenic
1094421520 12:30276642-30276664 TGGGAATCAGCACATGAGTGAGG - Intergenic
1095076348 12:37932207-37932229 TGGGAATACACTGATGACTATGG - Intergenic
1095515442 12:43000382-43000404 TGGGAAGACGCAAATGACTAGGG + Intergenic
1096283705 12:50279529-50279551 TGAGAATAGGAAGCTGAGCAGGG + Intronic
1096578861 12:52571607-52571629 TGGGAATAGGGAAAGGAGGATGG + Intronic
1098567300 12:71951018-71951040 TGAGAATAGGCACATGTGAAAGG - Intronic
1098730452 12:74030251-74030273 TGAGAATAAGAAGATGAGGAAGG - Intergenic
1099186373 12:79519889-79519911 TGGGTAAAGGCAGATGGGGAAGG + Intergenic
1099280797 12:80642988-80643010 TGGGAATAGTGTGATGAGAAAGG + Intronic
1100218654 12:92480221-92480243 TGAGAATAAAAAGATGAGTAAGG - Intergenic
1106125961 13:26900216-26900238 TGGGGATGGGCAGATGAGAGAGG - Intergenic
1107000694 13:35541268-35541290 TGGGAAAAGGCAGGGGAGTGGGG - Intronic
1107964066 13:45583925-45583947 TGAGAATACGCAGAGGTGTAAGG - Intronic
1109754868 13:66743988-66744010 TGGGAAAGGGCAGATGAGAAAGG + Intronic
1110009776 13:70317630-70317652 TGGGAATATGTAGATAAGTGAGG - Intergenic
1110315341 13:74100134-74100156 TGGTAACAGGCAGATGAGATAGG + Intronic
1110885636 13:80630817-80630839 AGGGAATAAGCTGATGAGTCAGG - Intergenic
1112474462 13:99718205-99718227 GGGGAATGGGGAGATAAGTAGGG + Intronic
1116177161 14:41486239-41486261 TGTGAAGAGGCAGACTAGTATGG + Intergenic
1118026918 14:61778529-61778551 TGAGTATAGGCAGATGAGGAGGG + Intronic
1118062135 14:62151220-62151242 TGGGGAGAGGGAGATGAATATGG + Intergenic
1118177592 14:63457149-63457171 TGGGACTAGGTAGATGAGAGAGG - Intronic
1122903852 14:104793043-104793065 TGGGAATGGGGAGGTGAGCAAGG - Exonic
1123894731 15:24817320-24817342 TGTGAATAGGCAGCTGTGCAGGG - Intergenic
1125140263 15:36398025-36398047 TTGGAAAAGGAAGATGTGTATGG + Intergenic
1126944411 15:53803061-53803083 TGGGAATATACAGATAAGCAAGG + Intergenic
1128128062 15:65207407-65207429 AGGGAGTGGGGAGATGAGTATGG - Intronic
1129649965 15:77478165-77478187 TGAGAATAGGGAGATGAGGTGGG + Intronic
1130139193 15:81209355-81209377 TGGGAATGGGCAGAGGGATATGG + Intronic
1130141414 15:81229359-81229381 TGGGAATGGGCAGAGGGATATGG + Intronic
1135648949 16:24188612-24188634 TGGGAATAGCCATCTGAGTAAGG - Intronic
1135768013 16:25194712-25194734 TGACAAGAGGCAGATGAGTAGGG + Intergenic
1136144276 16:28306739-28306761 TGGGAATAGTGAGATGAGGAAGG - Intronic
1137738780 16:50744160-50744182 TGGGAATATGCAGATGTGAGAGG + Intronic
1138924107 16:61569763-61569785 TGGCCATAGGCAAATGACTATGG - Intergenic
1139162939 16:64533670-64533692 TGGGAAAATGGAGATGAATAAGG - Intergenic
1139307422 16:65999040-65999062 TGGGAATTGGAAAATGAGGAAGG + Intergenic
1141514549 16:84535055-84535077 TGGGAGAAGGAAGAGGAGTAAGG - Intronic
1142411965 16:89921476-89921498 TGGGAGTAGGCAGGTGGGGAAGG + Intronic
1143399680 17:6636271-6636293 TGGGAGGAGGCACATGAGCAAGG + Intronic
1143962543 17:10732422-10732444 TGGGGATAGGCAGGTGACTTTGG + Intergenic
1147241591 17:39094202-39094224 TGGGAATATCTAGATGAGGATGG + Intronic
1147864045 17:43541432-43541454 GGGGACGAGGCAGATGATTAAGG + Intronic
1148581490 17:48747125-48747147 GGGGAACAGGCAGATAAGGATGG - Intergenic
1149134733 17:53350920-53350942 TGAGATCAGGGAGATGAGTAGGG - Intergenic
1149560627 17:57605577-57605599 GGGGAAGAGGCAGAAGAGAAGGG - Intronic
1151533641 17:74724642-74724664 TGGGGATAGGCAGTGGAGTTAGG + Intronic
1152425785 17:80217932-80217954 TGGGTATAAGCAGATGGGCATGG + Intronic
1153440748 18:5116752-5116774 GGGTAATAGGCAGAAGAGTTTGG + Intergenic
1156023898 18:32630213-32630235 GGGGCATAGGCAGGTGAATATGG - Intergenic
1156114354 18:33769216-33769238 TGGGAATTTGGAGATAAGTAAGG - Intergenic
1156997699 18:43487045-43487067 TGGCCATAGGCAGGTGAATATGG - Intergenic
1157311855 18:46559064-46559086 TGGGCCTTGGCAGGTGAGTATGG - Intronic
1157318596 18:46616369-46616391 TGGGAATGGGGAGATCAGCAGGG + Intronic
1157754300 18:50204402-50204424 TGGGAATAGGAAGATGATAGGGG - Intergenic
1158354191 18:56598131-56598153 TAGGAATATGCAGTTGAGGAAGG - Exonic
1158495404 18:57950821-57950843 TAGGAGTAGAAAGATGAGTAAGG + Intergenic
1158887918 18:61846360-61846382 TGGGTAGAGGGAGATGAGAAGGG - Intronic
1162883884 19:13681790-13681812 TGGGTGTAGCCAGATGAGTAAGG + Intergenic
1162902999 19:13806375-13806397 TGGGAATTGGAAGCTGAGTGTGG + Intronic
1163174447 19:15554386-15554408 TGGGACTAGGCAGATCAGTTAGG + Intergenic
1163363988 19:16866039-16866061 TGGGATTATGCAGCTGAGTGAGG + Intronic
1163691364 19:18740274-18740296 AGGGAAGAGGCAGATGGGCAGGG + Intronic
925237909 2:2295224-2295246 TGGGAAGAGACAGATGAGGAAGG + Intronic
925966182 2:9068564-9068586 TGGGAATTTACAGATAAGTAAGG - Intergenic
926615624 2:14994327-14994349 TGGGAATAGAAAGATGAGAGAGG + Intergenic
928586253 2:32761400-32761422 TGAGAATAGGCAGAGGGGCAAGG - Intronic
929938090 2:46309611-46309633 TTTGGATAGGCAGATGAGTATGG + Intronic
930372474 2:50520794-50520816 TTGAAATAGGCAGATAAATATGG - Intronic
931683627 2:64773411-64773433 TGGGAAGAGGCAGAGGAGGCTGG + Intergenic
933307120 2:80615074-80615096 TGTGAATAGGCAAAAGAGAAGGG + Intronic
933481856 2:82868176-82868198 TGGGAATAGACATGTGATTATGG - Intergenic
933702142 2:85263220-85263242 TGGGAATAGGCAGTTGGAGATGG + Intronic
934130915 2:88947857-88947879 TGGGAACATGCAAATGAGCAGGG + Intergenic
934132926 2:88966819-88966841 TGGGAACATGCAAATGAGCAGGG + Intergenic
934135555 2:88992965-88992987 TGGGAACATGCAAATGAGCAGGG + Intergenic
934140339 2:89040779-89040801 TGGGAACATGCAAATGAGCAGGG + Intergenic
934146565 2:89100415-89100437 TGGGAACATGCAAATGAGCAGGG + Intergenic
934148306 2:89117898-89117920 TGGGAACATGCAAATGAGCAGGG + Intergenic
934220984 2:90082713-90082735 TGGGAACATGCAAATGAGCAGGG - Intergenic
934222701 2:90100160-90100182 TGGGAACATGCAAATGAGCAGGG - Intergenic
934234753 2:90220805-90220827 TGGGAACATGCAAATGAGCAGGG - Intergenic
936732105 2:115395212-115395234 TGGGGAGAGGCAGAAGAGTGGGG - Intronic
939094721 2:137821518-137821540 GGGGAACAGGCAGATGGGGATGG - Intergenic
940177052 2:150890036-150890058 TGAGAATAGGTAGATGATCATGG - Intergenic
943044810 2:182847905-182847927 TGGGATTTGCCAGATGAGTATGG + Intronic
943712531 2:191113011-191113033 TGGGAATACTCACACGAGTAGGG + Intronic
943874789 2:193051509-193051531 TGGGAAAAGGCAGATGAACAGGG + Intergenic
944525604 2:200615739-200615761 TATGAATAGCCAGATGAATACGG - Intronic
946267683 2:218561823-218561845 TGGGAATAGACAGGTAAGCAGGG - Intronic
948720327 2:239895191-239895213 TGGGAATAGGTAAGTGAGTTGGG - Intronic
1168808624 20:688432-688454 AGGCAAAAGGCAGATGCGTAAGG + Intergenic
1169051857 20:2585685-2585707 TGGGAACAGCCACATAAGTAAGG - Intronic
1170803931 20:19613358-19613380 TGGGGATAGGCACTTGATTATGG - Intronic
1171172691 20:23029528-23029550 TGGGAATGGGAAGAGGGGTAAGG + Intergenic
1171343931 20:24451821-24451843 TGGGAATGAGCACATGAGTGAGG - Intergenic
1171431735 20:25087177-25087199 TGGGAGTGGGCACATGAGTTTGG + Intergenic
1172020683 20:31911614-31911636 AGGGATTAGGCTGATGAGCACGG + Intronic
1172172060 20:32943130-32943152 TGGGTATTGGGAGATGAATAGGG - Intronic
1172675019 20:36663274-36663296 TGAGAATATGCAGATGTGAAAGG - Intronic
1173209598 20:41021883-41021905 TGGAAATAGGCAGATTAGCTCGG - Intergenic
1174562811 20:51443513-51443535 TGGGAATCAGCTGATGAGGAAGG + Intronic
1176869686 21:14074975-14074997 TGGGGAGAGGCGGATGAGTGAGG - Intergenic
1177370122 21:20192045-20192067 TGGGAATAAACAGATAAGGAAGG - Intergenic
1177476052 21:21624827-21624849 TGATAATAGGCAGCTGAGAAAGG + Intergenic
1177852217 21:26362134-26362156 GGGCCATAGACAGATGAGTAAGG + Intergenic
1177876654 21:26641279-26641301 AGGGAATAAGCAGGTGAGCAGGG - Intergenic
1179437977 21:41375099-41375121 TGGGAATGGGCAGAGGAGCAAGG - Intronic
1181350131 22:22249243-22249265 TGAGAATCTGCAGATTAGTAGGG - Intergenic
1181600885 22:23951330-23951352 TGGGAAGAGTCAGCTGAGCAGGG - Intergenic
1181607628 22:23989996-23990018 TGGGAAGAGTCAGCTGAGCAGGG + Intergenic
1181807231 22:25382576-25382598 TGGGTTTAGACAGATGAATAAGG - Intronic
1183969754 22:41468222-41468244 TGGGGGTAGGGACATGAGTAAGG + Intronic
1184068329 22:42132876-42132898 TGGGAAGAGGCAGATGGCTCTGG + Intergenic
1184650580 22:45917796-45917818 TGGGAGGAGGCACATGAGTTGGG + Intergenic
949562826 3:5218558-5218580 TGGGAATAGGAAGATGGGCCAGG - Exonic
950173463 3:10855051-10855073 AGGGAATTGGGAGATGGGTAGGG + Intronic
951895146 3:27602998-27603020 TTGGAATAGGCAGTGGAGTTAGG - Intergenic
953247507 3:41208386-41208408 TGGGAATATGTAGTTGAGTTAGG - Intronic
953491346 3:43354565-43354587 TGGGGAGAGACAGATGAGAAGGG + Intronic
954394921 3:50288369-50288391 TGGGAATAGGGGGAAGAGAAAGG + Intronic
954991533 3:54844562-54844584 TTGGAATAGAGAGATGAGAAGGG - Intronic
955314608 3:57925870-57925892 CAGGAATAGGCCGATGAATACGG - Intronic
955829359 3:62984876-62984898 AGGGAAAAGGCAGATGAGAACGG - Intergenic
956211956 3:66811280-66811302 TGGGGATAGGCAGTTAAGAAAGG + Intergenic
956804553 3:72796199-72796221 GGAGAATAAGCAGATGAGTTTGG + Intronic
958181687 3:90068794-90068816 CAGGAATAGGCAGAAGAATATGG - Intergenic
958970934 3:100609567-100609589 TGGGAATAGGGAGATAACTCAGG - Exonic
960731121 3:120728147-120728169 TGGGGATAGGAAAAGGAGTAGGG + Intronic
961475760 3:127145402-127145424 TGGGAATAGGCACAGCAGTAGGG - Intergenic
962269499 3:133967744-133967766 TGGGGATGGGCAGATGTGCAAGG - Intronic
963844394 3:150140691-150140713 GGGGCATAGGCAGGTGAATATGG + Intergenic
964638092 3:158879540-158879562 GGGGAAGAGGCAGGTGAGCAGGG - Intergenic
964667858 3:159193449-159193471 TGGGTATACTCAGATGAGTATGG - Intronic
965041372 3:163511612-163511634 TGGGTTTAGGCTGGTGAGTAGGG - Intergenic
967001989 3:185344618-185344640 TGGGCATAGTCAGAGGAGGAAGG - Intronic
968204717 3:196789392-196789414 AGGAAATAGGCAGAGAAGTATGG - Intronic
969265937 4:6064072-6064094 TGGGAAGAGGCAGAAGAGCAAGG + Intronic
969485917 4:7472349-7472371 TGGGAAAGGGCAGAGGAGCAGGG + Intronic
971262243 4:25067587-25067609 TGTGAACAGCCAGATGAGAAAGG - Intergenic
972583988 4:40419832-40419854 AGGAGTTAGGCAGATGAGTAGGG - Intergenic
972702170 4:41504542-41504564 TGGGAATCTGAAGGTGAGTATGG - Intronic
972859202 4:43146565-43146587 TGGCAATTGGCAGGTGAGTGGGG + Intergenic
975657249 4:76653922-76653944 TGGGGATACAAAGATGAGTAAGG + Intronic
975818502 4:78244892-78244914 TGGGAAGAGGCAGAAGACTCAGG - Intronic
975929073 4:79495767-79495789 TGGGAAAAGGCTCAGGAGTAAGG + Intergenic
978468843 4:109039161-109039183 TGGGAAGAGAGAGATGATTAGGG - Intronic
978660968 4:111125889-111125911 TGGAAATATCTAGATGAGTAAGG - Intergenic
979045674 4:115859590-115859612 TGGGAGGAGGGAGAGGAGTAAGG + Intergenic
980512132 4:133806934-133806956 TTGGAATAGACAGAAAAGTAGGG + Intergenic
982538707 4:156640218-156640240 TGATAATTGGCAGATGAATAGGG - Intronic
983567799 4:169173234-169173256 TGGGATTAGGTGGATGAGCAGGG - Intronic
984760590 4:183359611-183359633 TGGGATTAGGCAGAGGAGAGTGG + Intergenic
985705878 5:1401096-1401118 TGGGCATTGGCAGGTGAGGAGGG - Intronic
986299405 5:6466346-6466368 TGGGAGGAGGCAGATGGGTTGGG - Intronic
986813029 5:11380222-11380244 TGGGCATATGCAGATGAATGAGG - Intronic
987299013 5:16580552-16580574 TGTGAATGGGCAGATCAGCAAGG - Intronic
988539679 5:32097791-32097813 TGGGAATACGAAGATGAATGAGG - Intronic
988998376 5:36736306-36736328 TGGGAATGTGCAGGTGACTATGG - Intergenic
989030892 5:37117257-37117279 GGGTAATAGGAAGATGAGCAAGG + Intronic
991015988 5:61933235-61933257 TGGGAATAGGCGGGTTAGAAAGG - Intergenic
993265344 5:85720080-85720102 TGGGAATGGGCAGATGAAGGAGG - Intergenic
994559294 5:101346942-101346964 TGGGAGTAGGCAGAATATTAAGG - Intergenic
994763859 5:103891713-103891735 AGGGAATATACAGATGAATAAGG + Intergenic
997296687 5:132773069-132773091 TGGGAAGAGGCAGCGGAGGACGG - Intronic
999519749 5:152339032-152339054 TGGGAATATGAATAGGAGTAAGG - Intergenic
1000545662 5:162598165-162598187 TCGGAATAGGCAAATGTATACGG - Intergenic
1001023083 5:168200077-168200099 TGGGACAAGACAGATGCGTATGG + Exonic
1003696848 6:8415615-8415637 TTGGAATATACAGATGAATAAGG - Intronic
1003775800 6:9361984-9362006 TGGGAAAATGGAGATGAGGAAGG + Intergenic
1004820547 6:19363718-19363740 TCAGAATAGGCAGAAGAGTGGGG - Intergenic
1006299603 6:33186520-33186542 TGGGAATAGGGAGATGAGGGTGG + Intronic
1008623689 6:53297181-53297203 TGGTTATTGGCAGATGGGTATGG - Intronic
1010359571 6:74977372-74977394 TGGGAATAAGAAGAGGAGTCAGG - Intergenic
1011524331 6:88246965-88246987 TGGGAATCAGCAGATGAAGAGGG - Intergenic
1012460998 6:99459866-99459888 GGGGAATAGGGAGAGGAGTGGGG + Intronic
1013481759 6:110558788-110558810 TGGGAACTGGGAGCTGAGTAGGG + Intergenic
1013634553 6:112016644-112016666 TGGAAATAGGCGAATGAGAAAGG - Intergenic
1013821385 6:114157199-114157221 TGGGAACAGGGAGAAGAGGATGG - Intronic
1015108262 6:129563091-129563113 GGGGAAAAGGCAGAGGAATAAGG - Intergenic
1015646129 6:135390595-135390617 TAGGAATAGGCAGTTTGGTATGG + Intronic
1017075158 6:150611076-150611098 TGGGAACAGAAGGATGAGTATGG - Intronic
1020836561 7:13159805-13159827 GGGGAAGAGGGAGATGAGAAAGG + Intergenic
1022098162 7:27153667-27153689 TGGGAAAGGGGAGGTGAGTATGG - Intergenic
1023409358 7:39874004-39874026 TGGGATAAGGAAGATGAGGAAGG - Intergenic
1024518343 7:50281295-50281317 TGGCAATAGGCATATAAGTCAGG - Intergenic
1025043574 7:55670024-55670046 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1025136494 7:56418533-56418555 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1026080240 7:67211667-67211689 TGGGAATTTACAGATGAGCAAGG - Intronic
1026696848 7:72602336-72602358 TGGGAATTTACAGATGAGCAAGG + Intronic
1027929330 7:84510762-84510784 TGGAAATATGCATAAGAGTATGG + Intergenic
1028010572 7:85637864-85637886 TGGGTTTATGCAGATGAGAATGG + Intergenic
1028110501 7:86934961-86934983 AGGGAATAGACAGAAGAATATGG - Intronic
1031034038 7:116767401-116767423 TGAGAATATAAAGATGAGTAAGG - Intronic
1031115049 7:117658514-117658536 TGGGAATAGGCAGATAATGGAGG - Intronic
1031549387 7:123089659-123089681 TGGGAATAGGAAGATAACAAGGG - Intergenic
1031772747 7:125865738-125865760 TGGGAAAATGAAGATGAATAAGG - Intergenic
1031937677 7:127752398-127752420 TGGAAATAGAAAGATGAATATGG + Intronic
1034087978 7:148337583-148337605 TGGCAAGACGCAGATGAGAAGGG - Intronic
1037234591 8:16703076-16703098 TGGGAATCTGTAGATTAGTATGG - Intergenic
1037370882 8:18177167-18177189 TGGGAAGAGACAGATGAGGAAGG - Intronic
1039446221 8:37635261-37635283 TGGGAATTTGCAGATTAGTGAGG - Intergenic
1039572663 8:38600048-38600070 TAGGAATAGAAAGATCAGTAGGG - Intergenic
1039883235 8:41639999-41640021 TGGGTATGGGCAGATGAGCATGG - Intergenic
1039926180 8:41934139-41934161 TGCTAATATGCAGAAGAGTAGGG - Exonic
1040724870 8:50370413-50370435 TGGGAAGACCCTGATGAGTATGG + Intronic
1042198529 8:66256075-66256097 TGAGAATACAAAGATGAGTAAGG + Intergenic
1042384278 8:68154747-68154769 TTGCAATAGGCAGATTAATAAGG + Intronic
1044247305 8:89963979-89964001 TGGGAAAAGGCAGCTGTGTGAGG - Intronic
1045349168 8:101322579-101322601 TGGGAAAAGACAGATGACCAGGG + Intergenic
1045591043 8:103598425-103598447 TACGAATAGGAAGATGAATAAGG - Intronic
1046514454 8:115240534-115240556 TGGGAATAGAAAGACGAGTAAGG + Intergenic
1047199125 8:122749069-122749091 TGGGGATAGGCTGATAACTATGG - Intergenic
1047554546 8:125914827-125914849 TGGGAATGGACATATGAGAAAGG + Intergenic
1050797888 9:9567876-9567898 TGGCAATAGGCAGAAGAGTGGGG + Intronic
1051007269 9:12360894-12360916 TGAGAGCAGGCAGCTGAGTATGG - Intergenic
1053030471 9:34772733-34772755 TGGGAATTTGCAGATGAGCAGGG + Intergenic
1053083581 9:35198080-35198102 TATGAATAGGAAGATAAGTATGG - Intronic
1053205456 9:36182576-36182598 TGGGAATAGGGGGAGGAGGAAGG + Intergenic
1053715906 9:40886444-40886466 TTGGAATAGGCAGTGGAGTTAGG - Intergenic
1054406285 9:64765619-64765641 TAGGAATAGGCAAATCAGCAGGG + Intergenic
1054805588 9:69393512-69393534 TGGGAATGGGCGGATAAGAACGG - Intergenic
1057114108 9:92504303-92504325 TGGAAATAGGAAGAAGAGGAAGG + Intronic
1058351247 9:104027304-104027326 TGAGAATAGAAAGATGAGGAGGG + Intergenic
1058799543 9:108531396-108531418 TGTAAATAGGCAAATGAGGATGG - Intergenic
1059763354 9:117360503-117360525 TGGGGATATGGAGATGAGCAGGG + Intronic
1059796830 9:117706686-117706708 TGGGTCTTGGAAGATGAGTAAGG - Intronic
1062645268 9:137544536-137544558 TGTGAAAGGGCAGATGAGTTAGG - Intronic
1186027313 X:5327238-5327260 TGCCAATAGGCAGATTAATAAGG + Intergenic
1189076351 X:37919466-37919488 AGGGAATTGGCATATGAATATGG - Intronic
1190387090 X:49892914-49892936 GGGGAGTAGGGAGATGAGTTAGG + Intergenic
1190526596 X:51334322-51334344 TGGGAGTTGGAAGTTGAGTATGG - Intronic
1190542654 X:51495039-51495061 TGGGAGTTGGAAGTTGAGTATGG + Intronic
1190559545 X:51673380-51673402 GGGGAAAAGTCAGATGAGTCCGG - Intergenic
1190564746 X:51719941-51719963 GGGGAAAAGTCAGATGAGTCCGG + Intergenic
1192577306 X:72253283-72253305 TGGGAATAGGGAGACTAGTTAGG - Intronic
1192773569 X:74218476-74218498 TGTGAATACAAAGATGAGTAAGG + Intergenic
1192947655 X:75983463-75983485 TGTGCATAGGCAGATAAGCAGGG - Intergenic
1193827856 X:86248470-86248492 TAGGAATACGCAAATGAGGAAGG + Intronic
1194656165 X:96576393-96576415 TGGGAATAGTTACATAAGTATGG - Intergenic
1194675234 X:96786024-96786046 AGGGAACAAGTAGATGAGTAGGG + Intronic
1195007731 X:100702731-100702753 TGGGGATACAAAGATGAGTAAGG + Intronic
1195399105 X:104442987-104443009 TGGGAATAGGGTGGTGAGCATGG + Intergenic
1195403957 X:104492489-104492511 AGGGAATTGGCAGAAGAGTGAGG - Intergenic
1195661511 X:107383711-107383733 TAGGACTAGGGAGATGAGTTAGG + Intergenic
1196384046 X:115128657-115128679 TAGCCATAGGCAAATGAGTATGG + Intronic
1197276434 X:124484900-124484922 TGAGAATAGAGAGATGAATATGG - Intronic
1198252583 X:134894987-134895009 TTGGAGTAGGCAGATGAATGAGG - Intronic
1200329500 X:155281705-155281727 TGGGAATAGGGAGAATAGTCAGG - Intronic
1201441022 Y:14008708-14008730 GGGGAAGAGGAAGGTGAGTAGGG - Intergenic
1201443549 Y:14034000-14034022 GGGGAAGAGGAAGGTGAGTAGGG + Intergenic
1202169097 Y:22021967-22021989 TGGGCTGAAGCAGATGAGTAGGG + Intergenic
1202222264 Y:22564401-22564423 TGGGCTGAAGCAGATGAGTAGGG - Intergenic
1202320851 Y:23631260-23631282 TGGGCTGAAGCAGATGAGTAGGG + Intergenic
1202549916 Y:26038796-26038818 TGGGCTGAAGCAGATGAGTAGGG - Intergenic
1202598476 Y:26568524-26568546 TGGGGATGGGGAGATGTGTAGGG - Intergenic