ID: 1068931444

View in Genome Browser
Species Human (GRCh38)
Location 10:62594469-62594491
Sequence CCCTGCTAGGTAGTGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931444_1068931454 11 Left 1068931444 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1068931454 10:62594503-62594525 CGGCTGATGCTCTGGGTCTGTGG No data
1068931444_1068931450 -9 Left 1068931444 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1068931450 10:62594483-62594505 CTAGCAGGGTGCCTGGCTCTCGG No data
1068931444_1068931452 3 Left 1068931444 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931444_1068931455 19 Left 1068931444 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1068931455 10:62594511-62594533 GCTCTGGGTCTGTGGACTGATGG No data
1068931444_1068931453 4 Left 1068931444 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1068931453 10:62594496-62594518 TGGCTCTCGGCTGATGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931444 Original CRISPR CCCTGCTAGGTAGTGGGAAT AGG (reversed) Intronic
900127090 1:1073497-1073519 CCCTGCCATGAAGTGGGATTGGG - Intronic
900290257 1:1920718-1920740 CCCAGCACGGGAGTGGGAATGGG + Intergenic
902687640 1:18089286-18089308 CCATGCTAGGAAGCAGGAATGGG + Intergenic
903243324 1:21998657-21998679 CCCTTCTAGGTACTGGGAATCGG + Intergenic
903346993 1:22692727-22692749 GGTTGCTAGGTATTGGGAATTGG + Intergenic
904654973 1:32038058-32038080 GCCTTCTAGGTACTGGGAAATGG - Intronic
904903318 1:33875017-33875039 CTCTGCCAGGAAGTGGGAAAGGG + Intronic
912082512 1:105954095-105954117 GCCTGCTGGGTGGTGGGAGTAGG - Intergenic
912938242 1:114022373-114022395 CCCAGCTTGGTTCTGGGAATGGG + Intergenic
912971065 1:114283598-114283620 CTGTGCTAAGTATTGGGAATGGG - Intergenic
913686559 1:121237647-121237669 CCCTTCTTGGTAGGGGTAATGGG - Intronic
914462994 1:147902161-147902183 CACAGCTAGATAGGGGGAATGGG - Intergenic
915952547 1:160199139-160199161 CCCAGCTAGGAGGTGGGGATGGG - Intronic
918750639 1:188265360-188265382 CCCTGCAAGGTAGAAGGGATTGG - Intergenic
921532729 1:216305839-216305861 CCCTGCAAGCTAGAAGGAATTGG - Intronic
922251392 1:223851996-223852018 CCCTCCAAGGTAGTTGGAGTAGG + Intergenic
922395846 1:225200684-225200706 CCCTACTAGCTAGAAGGAATTGG - Intronic
1063352233 10:5366168-5366190 CCCTGTGAGGTGCTGGGAATTGG + Intronic
1063421245 10:5914328-5914350 CCCTGGCAGGTAGCGGGAAGGGG - Intronic
1068131532 10:52901433-52901455 CCCTACTAGAAACTGGGAATTGG - Intergenic
1068931444 10:62594469-62594491 CCCTGCTAGGTAGTGGGAATAGG - Intronic
1069668026 10:70177416-70177438 CTATGCTAGGCACTGGGAATAGG + Intergenic
1070773533 10:79096723-79096745 CCCTGCTAGGCTCTGGGAATAGG + Intronic
1074091683 10:110265596-110265618 GTGTGCTAGGTAATGGGAATAGG + Intronic
1076234914 10:128856087-128856109 CACTGCTGGGAAGTGGGAAGTGG + Intergenic
1079112522 11:17612787-17612809 CCCTGCTGGGGACTAGGAATGGG + Intronic
1081473738 11:43403383-43403405 CCTTGCTAGATAATGAGAATGGG - Intronic
1081585811 11:44382834-44382856 ACCTGCTAGGATGTGGGACTAGG + Intergenic
1083291952 11:61695461-61695483 CCCCGCTGGGAAGTGGGAGTGGG - Intronic
1083347364 11:62002998-62003020 CCCTTCTAGGTACTGGGATACGG - Intergenic
1089612888 11:119679445-119679467 CCCAGCTAGGCAGAGGGAAGTGG + Intronic
1089620338 11:119718446-119718468 CCCTACTAGGGAGTGTGGATGGG - Intronic
1089623886 11:119739280-119739302 CCCAGCTGAGAAGTGGGAATTGG + Intergenic
1089977505 11:122745300-122745322 CTGTGCTAAGTACTGGGAATAGG - Intronic
1090313740 11:125766471-125766493 ACCTGCTAGGTATTGAGAAGTGG + Intergenic
1097031513 12:56093563-56093585 GTCTGCTAGGTGGTGAGAATAGG + Intronic
1098157660 12:67616832-67616854 AACTGCTTGGGAGTGGGAATAGG - Intergenic
1099605187 12:84794964-84794986 CCCGTCCAGGTAGTGGGAAGAGG + Intergenic
1102033451 12:109757971-109757993 CCCAGCTAGGGAGTGGGCAAGGG + Intronic
1109558884 13:64020812-64020834 CCCTACTATGTAGTGGTAAGAGG - Intergenic
1110484534 13:76022511-76022533 CCCTGCTAGGTACTGAAAACAGG - Intergenic
1114492180 14:23109905-23109927 CCCTGCTAGATGGTGGGCAGGGG + Intergenic
1115125784 14:29991909-29991931 CCATGCAAAGCAGTGGGAATAGG + Intronic
1117243713 14:53862108-53862130 CCTTGGTAGGTCCTGGGAATAGG + Intergenic
1119200569 14:72748941-72748963 CTCTGCTAGGCAGTGTGAAAGGG + Intronic
1119219576 14:72894874-72894896 TCCTGCTAGGTGGTGGGACCTGG + Intergenic
1124892447 15:33745682-33745704 CCCCTCTAGGCAGTGGCAATAGG + Intronic
1125434504 15:39630601-39630623 CCCCACTAGGTAGTTGGAAGAGG - Intronic
1128830241 15:70762731-70762753 CCCAGCGAGGCAGAGGGAATCGG - Intronic
1131264259 15:90906429-90906451 CAATGCAAAGTAGTGGGAATTGG - Exonic
1135204724 16:20473749-20473771 CCATGATAGGAAGTGGGAGTGGG + Intronic
1137297642 16:47111678-47111700 CCCTCATAGGAAGTGGGACTGGG + Intronic
1137607969 16:49799475-49799497 CCCTGCACTGTAGTGGGAACAGG - Intronic
1137724372 16:50646955-50646977 CCCTGCTAGTTACTGGGGCTGGG - Intergenic
1139210462 16:65071963-65071985 CCCTGCTGGGTAGTAGTAACTGG + Intronic
1141234148 16:82199875-82199897 CCATGCTAGGTGCTGGGAAATGG + Intergenic
1143794523 17:9325998-9326020 CCATGCTAGCTAGTGGGAAAAGG + Intronic
1145943759 17:28758465-28758487 CCCTGCTCGGTAGTGGGCCCCGG + Exonic
1146003597 17:29146998-29147020 CCCTGCGAGGTAATGAGAAGGGG + Intronic
1148163051 17:45462547-45462569 CCCAGCTAGGGGGTGGGAAGGGG - Intronic
1148538139 17:48457710-48457732 CCCAGTTAGGAAGTGGGAAGTGG + Intergenic
1148853943 17:50568506-50568528 CCCTGTGAGGTAGGGAGAATAGG + Intronic
1149305944 17:55346598-55346620 CCCTGCCTGGGAGTGGGAAGTGG - Intergenic
1149412510 17:56423314-56423336 CACTGCTAGCTAGTAGGAGTAGG - Intronic
1150394280 17:64809202-64809224 CCCAGCTAGGGGGTGGGAAGGGG - Intergenic
1153557518 18:6331375-6331397 CATTGCTGGGTAGGGGGAATTGG - Intronic
1162947985 19:14055037-14055059 CCCTGCTCTGGAGTGGGGATGGG + Exonic
926112599 2:10192660-10192682 CCCTGCTGGGTGGTGGAAGTGGG - Intronic
926621597 2:15051042-15051064 CTCTGCTAGGTACTGAGAAATGG - Intergenic
928995107 2:37281059-37281081 CCATCCTAGGTAGTGCGAAGTGG - Intronic
931008457 2:57880031-57880053 CTCAGCTAGGCTGTGGGAATAGG - Intergenic
935357912 2:102221622-102221644 TCCAGCTCGTTAGTGGGAATGGG - Intronic
939609582 2:144294102-144294124 CCCTGCTAAGTGGTGGAAATGGG - Intronic
942968892 2:181932733-181932755 CACTCCTAGGAAGTGGGAAGAGG + Intergenic
947413570 2:229869542-229869564 CCCAGCTCGGTAGGGGGAATGGG - Intronic
948502712 2:238406804-238406826 GCCTCCTAGGTAGTGGCATTGGG + Intergenic
1170667070 20:18395472-18395494 CCTGGCCAGCTAGTGGGAATGGG - Intronic
1170699862 20:18694287-18694309 CCCTGCTGAGAAGAGGGAATAGG - Intronic
1176697101 21:9991347-9991369 CCCTTCTTGGGAGTGGGGATAGG + Intergenic
1180703330 22:17793687-17793709 CCCTCCGAGGCAGTGGGGATGGG + Intronic
1184223931 22:43118354-43118376 CCCTGCTAGGTGGTGGAAAATGG + Intronic
1184416678 22:44355910-44355932 CACTGCTTGGTACTGGCAATGGG - Intergenic
1184564966 22:45286364-45286386 CCCTGCTCTGTAATGGGGATTGG - Intronic
951194133 3:19804700-19804722 CCCTCCTAGGAAGGGGGAAGGGG + Intergenic
951386184 3:22045514-22045536 CCTTGCTAGGAACTGGAAATGGG - Intronic
952646352 3:35663791-35663813 GCCTGCTGGGCCGTGGGAATTGG + Intronic
953576420 3:44116331-44116353 GCCTTCTGGGTAGTGGGAGTTGG - Intergenic
954452278 3:50578219-50578241 CCCTGCCAGGCAGGGGGAAAGGG - Intronic
954984218 3:54775395-54775417 CTCTGGTAGGTATTGGGAAATGG + Intronic
961144870 3:124585191-124585213 GCCTGCTAGGGAGTGGGATGCGG + Intronic
962210424 3:133472690-133472712 CACAGCTAGGCTGTGGGAATGGG - Intronic
963321059 3:143809873-143809895 CACTGGTAGCTAGTGGCAATTGG + Intronic
963581831 3:147135270-147135292 CTCTGCTAGGTAGTGTGGAAGGG - Intergenic
964690296 3:159442564-159442586 CTCTGCTAGGCAGGGAGAATGGG + Intronic
969795559 4:9525016-9525038 TCCTGGTAGGCACTGGGAATAGG + Intergenic
971222123 4:24718051-24718073 TCCTGTTAGTTACTGGGAATTGG + Intergenic
974648479 4:64724885-64724907 GCCTGATTGGCAGTGGGAATGGG + Intergenic
975330043 4:73102064-73102086 CCCAGCTAGCTACTGGGGATTGG - Intronic
975918256 4:79350434-79350456 TGCTGCTAGGAAGTGGGGATGGG + Intergenic
979528374 4:121741259-121741281 CCCTTCTAGGCAGAGGGAATAGG - Intergenic
980279419 4:130700175-130700197 CCATGATGGGAAGTGGGAATGGG - Intergenic
980369707 4:131851540-131851562 CCCTTCTTGGGAGTGGGGATAGG + Intergenic
981538659 4:145825674-145825696 TCTTGCTAAGTAGTGGCAATGGG + Intronic
982334931 4:154224558-154224580 CCATGATAGGAAGTGGGAGTTGG + Intergenic
989331743 5:40267736-40267758 CCCTGATAGGTACTGGGTAAAGG - Intergenic
989450204 5:41577839-41577861 CCGTGCTAGGTAGGGGCCATGGG - Intergenic
990201668 5:53383030-53383052 ACCTGTCAGGTAGTGGGAATAGG - Intergenic
990310737 5:54535620-54535642 CCCTGCTTGGAAGGGAGAATGGG + Intronic
992437212 5:76766275-76766297 ACCTGCCAGGTTGTGGCAATTGG + Intergenic
992829983 5:80584695-80584717 CCCTGCTTGGAAGTGAGAAGAGG - Intergenic
993792292 5:92222910-92222932 CCCTCCTAGGGAGGAGGAATGGG + Intergenic
996873532 5:128217150-128217172 CCCAGCAGGGGAGTGGGAATGGG - Intergenic
999839081 5:155404682-155404704 CCCTACAAGGTAGAAGGAATTGG + Intergenic
1000150692 5:158497828-158497850 CCCTCTTAGGCAATGGGAATTGG - Intergenic
1001599766 5:172921213-172921235 CCCAGCTAGGAAGTGGGGCTGGG + Intronic
1001906784 5:175479321-175479343 CCCTGCGAGGTACTGGGTGTTGG + Intronic
1002836823 6:871698-871720 CCATGCTAGTCAGTGGGAAGTGG + Intergenic
1006930376 6:37684260-37684282 GCCTGCTTGGTAGTGTGAACTGG - Intronic
1006943331 6:37767322-37767344 CCCAGGTAGGTAGTTGCAATGGG + Intergenic
1007740894 6:44008897-44008919 CCCTGATGGGTGGAGGGAATAGG + Intergenic
1009688196 6:66990874-66990896 CCCTGTTAGGTAGGTAGAATGGG + Intergenic
1009929468 6:70160037-70160059 CCCTCCTGGGTAGTGGGAATAGG - Intronic
1013451670 6:110287777-110287799 GCCTGCTAGGTACTTGGAATGGG + Intronic
1014307681 6:119762669-119762691 GCCTCCTAAGTATTGGGAATTGG - Intergenic
1014747250 6:125214414-125214436 CCCTGGTAGATTGTGGGAAGAGG - Intronic
1015987557 6:138899803-138899825 CCCTGGTGGGGAGGGGGAATTGG + Intronic
1019946845 7:4336787-4336809 CCTTGATAGGAAGAGGGAATCGG - Intergenic
1023489523 7:40723872-40723894 GCCTGCTAGGTGGTAGGAACTGG - Intronic
1024181793 7:46902717-46902739 CCATTCTAGTTAGTGGGAACAGG - Intergenic
1030229542 7:107192804-107192826 CCCTGCAAAGGAGTGGAAATGGG + Intronic
1031261512 7:119526508-119526530 CCCTGCAAGCTAGAAGGAATTGG + Intergenic
1032219875 7:129986487-129986509 CACAGCTAGGTAGGAGGAATAGG + Intergenic
1033971057 7:147040120-147040142 CCCTGCTAAAAAGTGGGAAAAGG + Intronic
1036119786 8:6003311-6003333 TTCTGCTAGGTAGAGGGAGTGGG - Intergenic
1038694156 8:29791074-29791096 CCCTGCAAGGCAGAGGGAAAAGG - Intergenic
1043912167 8:85875694-85875716 CCATCCCAGGTAGTGGGAAGAGG - Intergenic
1047681566 8:127259039-127259061 CCCTTCTAGATAGTGAGCATGGG + Intergenic
1048163049 8:132038465-132038487 CCCTGGTATGTAGTGTGACTGGG - Intronic
1048297448 8:133224954-133224976 TCTTGCTAGGTGCTGGGAATGGG - Intronic
1048450449 8:134528869-134528891 CCATGCTAGGCACTGGGACTTGG - Intronic
1049065916 8:140313825-140313847 TCCTGCTAGGGACAGGGAATGGG + Intronic
1049597168 8:143490093-143490115 CCCTGGCAGGTACTGGGGATGGG + Intronic
1052992107 9:34524519-34524541 CCCTGCTGGGTAATGGGCAGTGG - Intergenic
1053148333 9:35727145-35727167 CCCTGCTTGGTACAGGGATTGGG + Intronic
1053563156 9:39217270-39217292 CCCCTCTGGGTAATGGGAATGGG - Intronic
1053634089 9:39977200-39977222 CCCTTCTTGGGAGTGGGGATAGG + Intergenic
1054133991 9:61401785-61401807 CCCCTCTGGGTAATGGGAATGGG + Intergenic
1054209798 9:62273497-62273519 CCCTTCTTGGGAGTGGGGATAGG - Intergenic
1054315196 9:63575457-63575479 CCCTTCTTGGGAGTGGGGATAGG + Intergenic
1055789823 9:79911863-79911885 GCCTGATAGGGAGTGGCAATGGG + Intergenic
1057874987 9:98746983-98747005 CCCTGGCAGTGAGTGGGAATTGG - Intronic
1058151080 9:101464172-101464194 CCCTGATTGGTAGAGGGAAAGGG + Intergenic
1058753244 9:108060125-108060147 ACCTATTAAGTAGTGGGAATGGG + Intergenic
1058760330 9:108124497-108124519 CCCAGCCAGGAAATGGGAATGGG + Intergenic
1060410680 9:123398197-123398219 CCCTGCTGGGAAGTGGCAGTAGG - Intronic
1187120871 X:16405000-16405022 CCAAGTTAGGGAGTGGGAATTGG - Intergenic
1190007046 X:46750152-46750174 ACCTCCTAGGAAGTGGTAATGGG + Intronic
1192298215 X:69872060-69872082 CCCTACAAGGTAGAGGGGATTGG + Intronic
1198075046 X:133185964-133185986 AGCTAGTAGGTAGTGGGAATGGG - Intergenic
1199103394 X:143834213-143834235 CCCTGCAAGCTAGAAGGAATGGG + Intergenic
1200811094 Y:7486020-7486042 CCCTGCAAGGAAGAGGCAATTGG + Intergenic