ID: 1068931446

View in Genome Browser
Species Human (GRCh38)
Location 10:62594475-62594497
Sequence CAGGCACCCTGCTAGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 9, 3: 113, 4: 599}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931446_1068931455 13 Left 1068931446 10:62594475-62594497 CCCACTACCTAGCAGGGTGCCTG 0: 1
1: 0
2: 9
3: 113
4: 599
Right 1068931455 10:62594511-62594533 GCTCTGGGTCTGTGGACTGATGG No data
1068931446_1068931452 -3 Left 1068931446 10:62594475-62594497 CCCACTACCTAGCAGGGTGCCTG 0: 1
1: 0
2: 9
3: 113
4: 599
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931446_1068931454 5 Left 1068931446 10:62594475-62594497 CCCACTACCTAGCAGGGTGCCTG 0: 1
1: 0
2: 9
3: 113
4: 599
Right 1068931454 10:62594503-62594525 CGGCTGATGCTCTGGGTCTGTGG No data
1068931446_1068931453 -2 Left 1068931446 10:62594475-62594497 CCCACTACCTAGCAGGGTGCCTG 0: 1
1: 0
2: 9
3: 113
4: 599
Right 1068931453 10:62594496-62594518 TGGCTCTCGGCTGATGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931446 Original CRISPR CAGGCACCCTGCTAGGTAGT GGG (reversed) Intronic
900367107 1:2315780-2315802 CAGGCTCCCTGCTAGGAGGGCGG - Intergenic
900852979 1:5158224-5158246 CAGTCACCCTGCTGGGCAGCAGG - Intergenic
901299571 1:8189607-8189629 CAGGCACTGTGTTAGGCAGTGGG + Intergenic
902067015 1:13696920-13696942 CAGACACTCTTCTGGGTAGTGGG + Intergenic
902987319 1:20162779-20162801 CAGGCACAGTGCCAGGCAGTAGG - Intronic
903239520 1:21973725-21973747 CAGGCTCCCTTCTAGGTACTGGG + Intergenic
903243322 1:21998651-21998673 CAGGCTCCCTTCTAGGTACTGGG + Intergenic
903303965 1:22399752-22399774 CAGGCACGGTGCTAGGCACTGGG + Intergenic
903369108 1:22823794-22823816 CAGGCACTATGCTAGGTGCTGGG - Intronic
903820885 1:26101691-26101713 CAGGCACCGTGCTAGGCACTGGG - Intergenic
904201998 1:28825944-28825966 CAGGCACAGTTCTAGGTACTTGG + Intronic
904828859 1:33294087-33294109 CAGGCACTGTGCTAGGTATTTGG - Intronic
904847216 1:33429700-33429722 CAGGCACTCTGCTATGTCTTGGG - Intronic
904850854 1:33458346-33458368 CAGGCACTGCGCTAGGTGGTGGG - Intergenic
904899600 1:33846585-33846607 CAGGCACAGTGCTAGGCACTTGG - Intronic
905004201 1:34697188-34697210 CAGGCACCGTGCCAGGCATTTGG - Intergenic
905261706 1:36723592-36723614 CAGGCACTGTGCTAGGTTCTGGG + Intergenic
905292912 1:36935190-36935212 CAGGCACCGTGCTGGGTGCTGGG - Intronic
905317296 1:37091333-37091355 CAGGCACTCTACTAGGTGCTGGG - Intergenic
905338460 1:37261606-37261628 CAGGCATTCTGCTAGGCACTGGG - Intergenic
905340261 1:37273184-37273206 TAGGCACCCAGCTAAGCAGTAGG - Intergenic
905998129 1:42399851-42399873 CAGGCAGCATGCTAGGCACTGGG + Intronic
906211080 1:44012573-44012595 CAGGCACTGTGCCAGGAAGTGGG + Intronic
906265126 1:44422985-44423007 CAGGCACCATGCGAGGTACTGGG + Intronic
906861359 1:49363816-49363838 CAGGCACTCTGCTATGTACTAGG + Intronic
906977564 1:50592016-50592038 CAGGCACTATGCTAGGTGTTAGG + Intronic
907328158 1:53654207-53654229 CAGGCACGGTTCTAGGTACTTGG + Intronic
907734788 1:57101706-57101728 CAGGCACTCTGCTAGGCACTGGG + Intronic
907899019 1:58720493-58720515 CAGGCACTCTTTTAGGTACTGGG - Intergenic
908332884 1:63088093-63088115 CAGGCACGTTGCTAGGTAACGGG + Intergenic
908395153 1:63718676-63718698 CAGGCACTGTGCTAGACAGTGGG + Intergenic
908767069 1:67563834-67563856 CAGGCACTCTGCTAGGTGCTTGG - Intergenic
909430911 1:75586803-75586825 CAGGCACCGTGCTAGGCCCTTGG - Intronic
909529997 1:76671370-76671392 CAGGCACTCTGCTGGGTGCTGGG - Intergenic
910014893 1:82509939-82509961 CAGGCATTCTGCTAGGCATTAGG - Intergenic
910109404 1:83666828-83666850 CAGGCACTCTGCTAGGAACTGGG - Intergenic
910482817 1:87676845-87676867 CAGGCACAGTTCTAGGTACTGGG - Intergenic
910934317 1:92475196-92475218 CAGGCACCATGCTAGGTATTGGG - Exonic
911489279 1:98542367-98542389 CAGGAACTCTTCTAGGCAGTGGG + Intergenic
911648570 1:100361519-100361541 CAGGCACAGTGCTAGGTGTTGGG - Intronic
912372669 1:109185917-109185939 CAGGCACGGTGCTAGGTGCTAGG + Intronic
912376738 1:109215529-109215551 CAGGTACAGTGCTAGGTACTGGG - Intronic
913558610 1:119995784-119995806 TAGGCACCATGCTATGTATTTGG - Intronic
913639230 1:120794687-120794709 TAGGCACCATGCTATGTATTTGG + Intergenic
914255125 1:145956182-145956204 CAGGAACTCTGCTAGGTGCTGGG - Intronic
914279219 1:146155271-146155293 TAGGCACCATGCTATGTATTTGG - Intronic
914540262 1:148606201-148606223 TAGGCACCATGCTATGTATTTGG - Intronic
914763227 1:150615952-150615974 CAGCCACTCTACTAGGTGGTGGG - Intronic
915391991 1:155552131-155552153 CAGGCACTATTCTAGGTACTGGG - Intronic
915482900 1:156199389-156199411 CCTGCATCCTGCCAGGTAGTTGG + Intronic
915562825 1:156697388-156697410 TGGGCACCCTGCTAGGTACTAGG - Intergenic
916014019 1:160732527-160732549 CAGGCACTCTTCTAGTTACTGGG + Intergenic
916257630 1:162805882-162805904 AAGGCAGCCTGCTAGGAAATGGG - Intronic
916432493 1:164744607-164744629 CAGGCACTCTTCTAGCTACTGGG - Intronic
916478270 1:165191042-165191064 CAGGCACTGTGCTAGGCACTGGG + Intergenic
917634414 1:176920790-176920812 CAGGCACAGTGTTAGGTACTAGG - Intronic
917688069 1:177438304-177438326 CAGGCCCCATGCTAGGCACTTGG - Intergenic
917962583 1:180156148-180156170 CAGGCACCTTACTAAGTACTCGG + Intronic
918081661 1:181212423-181212445 CAGGCACTGTGCTAGGCACTGGG - Intergenic
918302132 1:183214230-183214252 CAGGCACCATGCTGGGCAGTGGG + Intronic
918406679 1:184218370-184218392 CAGGCACTGTGCTAAGTACTAGG - Intergenic
919076064 1:192814206-192814228 CAGGCACTATGCTAGGTGTTGGG - Intergenic
919613504 1:199776568-199776590 TAGGCACTCTGCTAGGCTGTAGG + Intergenic
919769473 1:201148047-201148069 CCAGCACCCAGCTAGGTACTGGG - Intronic
919844353 1:201631895-201631917 CAGGCACTGTGCTAGGTGATGGG - Intronic
919876684 1:201874500-201874522 CTGGCACCATGCTAGGCACTAGG + Intronic
919968966 1:202559169-202559191 CAGGCACCATGCTCGGTATTAGG + Intronic
920195890 1:204226954-204226976 CAGGCACTGTGCTAGGTGTTTGG + Intronic
920651513 1:207840737-207840759 CAGGCACCATTCTAGGTACTGGG - Intergenic
921269339 1:213453244-213453266 CAGGCACTATGCTAGGGACTGGG + Intergenic
921323961 1:213972356-213972378 AGGGCACCGTGCTAGGTAATGGG + Intergenic
921439271 1:215164886-215164908 CAGGCACTCTGCTAAGCACTAGG - Intronic
921940897 1:220838572-220838594 CAGGCACCTTGCTAGATGCTGGG + Intergenic
921971099 1:221150064-221150086 CAGGAACTGTGTTAGGTAGTGGG + Intergenic
922414400 1:225407303-225407325 CGGGCACTGTGCTAGGTACTGGG - Intronic
922606059 1:226890653-226890675 CAGGCACTGTGCTAGGCATTGGG + Intronic
922795504 1:228337662-228337684 CAGGCACCCTGTTAGGGCTTGGG + Intronic
923221839 1:231902298-231902320 CAGGCAGTATTCTAGGTAGTTGG + Intronic
923695064 1:236240694-236240716 CAGGCACCATTCTAGGCACTAGG + Intronic
924067945 1:240245605-240245627 CAGGCATTGTGCTAGGCAGTAGG - Intronic
924185189 1:241481312-241481334 CAGGCACTGTGCTAGGGACTGGG - Intergenic
924376219 1:243412136-243412158 AAGGCACTCTGCTAGGCACTGGG - Intronic
924531612 1:244898639-244898661 CAGGCACTCTACTAGGTGCTGGG - Intergenic
924587232 1:245370872-245370894 CAGGCACTGTGCTAGGTGGTGGG + Intronic
924644789 1:245867539-245867561 CAGGCACTGTTCTAGGCAGTAGG + Intronic
1062816129 10:501785-501807 CAGGCACTGTGCCAGGTATTTGG + Intronic
1063603566 10:7503775-7503797 CAGGCACTGTGCTAGGTACCAGG - Intergenic
1063720828 10:8579845-8579867 CAGAAACCCTGTAAGGTAGTTGG - Intergenic
1063820481 10:9829296-9829318 CAGACACTATGCTAGGTACTGGG - Intergenic
1064609092 10:17078601-17078623 CAGTCACCATGCTAGGGAATGGG - Intronic
1065152449 10:22836131-22836153 CAGGCACTTTGCTTGGTATTGGG + Intergenic
1065347357 10:24761254-24761276 CAAGTACCTTGCTAGGTACTAGG - Intergenic
1065376566 10:25049285-25049307 TAGGCACTTTGCTAGGTACTGGG + Intronic
1066724078 10:38371563-38371585 AAGGCAGCCTGCTAGGAAATGGG - Intergenic
1067214581 10:44292135-44292157 TAAGCACCCTGTTAAGTAGTTGG - Intergenic
1067249606 10:44575642-44575664 CAGCCACCCTGCTTGGGAGATGG - Intergenic
1067728694 10:48793145-48793167 CAGGCACTGTGCTAGGCACTAGG + Intronic
1068931446 10:62594475-62594497 CAGGCACCCTGCTAGGTAGTGGG - Intronic
1070039586 10:72762679-72762701 CAGGAACTATGCTAGGTACTGGG + Intronic
1070456534 10:76622753-76622775 CAGGCAACCTGCTGGATACTAGG - Intergenic
1070941755 10:80354524-80354546 CAGGCACCATGATAGGTACTGGG + Intronic
1072562517 10:96589184-96589206 AAGTCACCCTGCTAGGTGCTCGG - Intergenic
1072562569 10:96589693-96589715 CAGGCACTCTGGTAGGTACTAGG + Intergenic
1072606436 10:96987356-96987378 CAAGCACCTTACAAGGTAGTCGG - Intergenic
1072730967 10:97846510-97846532 CAGGCACTCTTCTAGGAAATTGG - Intergenic
1072831479 10:98663224-98663246 CAGGCACTGTTCTAGGTACTTGG + Intronic
1073637890 10:105218407-105218429 AAGGCACTCTGCTAGGCACTGGG + Intronic
1074462449 10:113650715-113650737 CAGGCACTGTGCTGGGTATTGGG - Intronic
1074691908 10:116013742-116013764 CAGGCACTCTGCTAGTTGCTAGG - Intergenic
1074787144 10:116850901-116850923 CATGCACTCTGCTGGGTACTAGG - Intronic
1074910610 10:117905284-117905306 CAGGCACTCTGCTAGGCACTGGG + Intergenic
1076399729 10:130173993-130174015 CAGGCACCCTGCAAGGATTTAGG + Intronic
1078478640 11:11656928-11656950 CAGGAATCCTGGTAGGTTGTTGG - Intergenic
1080792339 11:35532974-35532996 CAGGCACTATTCTAGGCAGTGGG + Intergenic
1080795524 11:35559609-35559631 CAGGCATCGTTCTAGGTACTTGG + Intergenic
1080808128 11:35675136-35675158 CAGGCACTGTGCTAGGTGCTGGG - Intronic
1080893314 11:36428064-36428086 CATGCACCCTGCAATGTTGTGGG - Intronic
1081077460 11:38694375-38694397 CAGGCACCGATCTAGGTACTAGG + Intergenic
1082215598 11:49563932-49563954 CAGGCATCATGCTAAGCAGTAGG + Intergenic
1082818202 11:57524681-57524703 CAGGCACCATTCCAGGTACTTGG - Intergenic
1083347366 11:62003004-62003026 CAGACACCCTTCTAGGTACTGGG - Intergenic
1083720175 11:64599984-64600006 CAGGTACCCTGGTAGGAAGGAGG + Intronic
1083815520 11:65130427-65130449 CAGGCCCCCTGCCTGGGAGTTGG - Intronic
1084095188 11:66906699-66906721 CAGGCTCCCTGCCAGGTCATGGG - Intronic
1084475697 11:69387400-69387422 CAGGCACTGTGCTAGGTGCTGGG - Intergenic
1084876594 11:72137987-72138009 CAGGCACTGTGCTAGGTCCTAGG - Intronic
1085062493 11:73460437-73460459 CAGTCACTGTGCTAGGTACTGGG + Intronic
1085132378 11:74051843-74051865 CAGGCACCATGCTAAGTACTAGG - Intronic
1085754816 11:79193630-79193652 CAGGGACCCTGCTATGTGGATGG - Intronic
1085774258 11:79351368-79351390 CAGGCACTCTCCCAGGCAGTGGG - Intronic
1086069996 11:82789674-82789696 CAGGCACCCTGCGATGTCCTAGG + Intergenic
1086141250 11:83503012-83503034 CAGGCACTGTGCTAGGAACTGGG + Intronic
1086272698 11:85087115-85087137 CAGGCATTATGCTAGGTACTAGG + Intronic
1086633981 11:89060550-89060572 CAGGCATCATGCTAAGCAGTAGG - Intronic
1088231631 11:107679022-107679044 CAGGCATTCTGCTAGGTACCTGG + Intergenic
1088786395 11:113186075-113186097 CAGGCACTATGCTGGGTATTGGG + Intronic
1088849699 11:113694879-113694901 CAGGCATTCTGTTAGGTACTAGG - Intronic
1089084101 11:115802354-115802376 CAGACACTCTGCTAGGAACTGGG - Intergenic
1089104886 11:115994236-115994258 CAGGCACTGTGCTAGGTCCTGGG + Intergenic
1089160512 11:116433524-116433546 CAGGCACCATGCTAGATTCTAGG + Intergenic
1089332091 11:117696673-117696695 CAGGCACCCTGCTAAGCACTGGG - Intronic
1089765314 11:120758895-120758917 CAGGCACTGTGCTAGGCACTGGG + Intronic
1090158547 11:124467187-124467209 GATGAACGCTGCTAGGTAGTAGG + Intergenic
1090267962 11:125365906-125365928 CAGGCACCGTGCTGGGCACTGGG - Intronic
1090304854 11:125682467-125682489 TAGGCATGCTGCTAGGTACTGGG - Intergenic
1090328376 11:125908831-125908853 CAGGCACTGTGCTAGGTATTAGG - Intronic
1090441204 11:126727101-126727123 CAGGCTCCATGCTAGGCACTGGG - Intronic
1090606038 11:128423813-128423835 CAGGCACCAAGCTAGGTGCTAGG + Intergenic
1091475468 12:768051-768073 CAGGCACCCTACTACATAGAGGG + Intronic
1091568377 12:1663527-1663549 CAGGCTGCCTGCTAGATTGTAGG + Intergenic
1091571674 12:1691699-1691721 CAGGCAGCCTGCTTGGTACCTGG + Intronic
1091689945 12:2589143-2589165 CAGGCACTGTGCTAGGTACCAGG + Intronic
1091731868 12:2886975-2886997 CAGGCATTCTGCTAGGTGCTGGG + Intronic
1091757262 12:3062200-3062222 CAGGCACAGTAATAGGTAGTTGG - Intergenic
1092232883 12:6786905-6786927 AAGGCACTCTGCTAGGTAGCTGG - Intronic
1092894300 12:12998263-12998285 CAGGCACTCTTCTAGGCAATGGG - Intronic
1093993144 12:25612595-25612617 CAGGCACCATGCTAGATACTGGG - Intronic
1094410102 12:30158795-30158817 AAGGCACCCTGCTAGGTGTCAGG - Intergenic
1095486222 12:42687393-42687415 CAGGCACTGTGCTAGGCAATGGG + Intergenic
1095704716 12:45224034-45224056 CAGGCACTCTGCTAGGTTCCAGG + Intronic
1095834813 12:46626004-46626026 CAGGCACCGTTCTAGGTTTTGGG + Intergenic
1095962739 12:47845610-47845632 CAGGCACTATGCTAGGTACTGGG - Intronic
1096000819 12:48128519-48128541 CAGGCACTATGCTAGGCACTGGG - Intronic
1096233693 12:49911730-49911752 CCGGCACCATGCTAGGTGCTAGG + Intergenic
1096314622 12:50553380-50553402 CAGGCACTGCGCTAGGTACTGGG - Intronic
1096539387 12:52296472-52296494 CAGGCACCCAGCTGGTTAGTGGG + Intronic
1096584660 12:52612046-52612068 TAGGCACTATGCTAGGTACTGGG - Intronic
1096604547 12:52755195-52755217 CAGGCACTGTGCTAGGCAATGGG - Intergenic
1097079352 12:56418508-56418530 CAGGCACTGTGCTAGGCACTGGG - Intronic
1097298064 12:57988790-57988812 CAGGCACTGTTCTAGGTAGTGGG + Intergenic
1097836317 12:64276190-64276212 CAGACACCATGCTAGGTGTTGGG + Intronic
1098008259 12:66021816-66021838 CAGGCCCTCTGCCAGGTATTGGG - Intergenic
1098515744 12:71374727-71374749 CAGACACCGTGCTGGGTACTAGG + Intronic
1099171975 12:79375804-79375826 CAGGCGCCCTGCTAGGTACCTGG - Intronic
1099248907 12:80228048-80228070 CAGGCACTGTTCTAGGTACTGGG - Intronic
1099543747 12:83950090-83950112 CATGCACTGTTCTAGGTAGTGGG + Intergenic
1099619386 12:84981868-84981890 CAGGCATTCTGCTTGGTACTTGG - Intergenic
1099713069 12:86253254-86253276 CAGGCACTCTTCTAGGTACTTGG - Intronic
1099953769 12:89332531-89332553 CAGGCACCATCCTAGGTGATAGG + Intergenic
1100399919 12:94220588-94220610 GAGGCACTATGCTAGGTACTAGG + Intronic
1101180699 12:102213786-102213808 CAGGCACTCTACTAGGCACTGGG + Intergenic
1101576458 12:106001654-106001676 CAGGCACTGTCCTAGGTACTTGG + Intergenic
1101812342 12:108118855-108118877 CAGGCACTCAGCTAAGTAATGGG - Intergenic
1101816267 12:108148353-108148375 CAGGCCCCTTTCTAGGTACTGGG - Intronic
1102202050 12:111063952-111063974 CATGCACCCGGCAAGGTGGTGGG + Intronic
1102416726 12:112769080-112769102 CAGGCACTGTGCTAGGTACTAGG - Intronic
1102469408 12:113151130-113151152 CAGGCACCCTTGTAGGCACTGGG - Intronic
1102689043 12:114746177-114746199 CAGGCACCATGCTAGGGGCTGGG + Intergenic
1103070617 12:117938200-117938222 CAGGCACCGTGCTGGGTACTGGG - Intronic
1103235578 12:119369786-119369808 CAGGCCCCGTGCTAGGTACTGGG - Intronic
1103423634 12:120811744-120811766 CAGGCACTCTGCTAGCCACTGGG + Intronic
1103852729 12:123943721-123943743 CAGGCATCGTGCTAGGTGCTAGG - Intronic
1103861013 12:124014001-124014023 CAGGCACTGTGCTAGGTGCTGGG + Exonic
1103887418 12:124213175-124213197 CAGACACCATGCTGGGTACTGGG - Intronic
1104172466 12:126295671-126295693 CAGGCACTCTGCTAAGTAATGGG - Intergenic
1105433833 13:20360617-20360639 TAGGCACTCTGCTGGGCAGTTGG - Intergenic
1105579646 13:21683311-21683333 CAGGCACTGTGCTAGGAACTGGG - Intronic
1105693300 13:22863531-22863553 CAGACACTCTTCTAGGTACTAGG + Intergenic
1106148720 13:27076609-27076631 CAGGCATGTTGCTAGATAGTGGG - Intronic
1106197603 13:27507649-27507671 CAGGCACTCTGCTAGGTGTTGGG - Intergenic
1106447790 13:29851786-29851808 CAGGCACTCTGCTAGGCACTAGG + Intergenic
1106693102 13:32140474-32140496 CAGGCACAGTTCTAGGTACTGGG + Intronic
1106700290 13:32221885-32221907 CAGGCACCATTGTAGGTAGTAGG + Intronic
1107263288 13:38520440-38520462 CAGGCACCATGCTCGGTACCAGG + Intergenic
1107797965 13:44073973-44073995 CAGGCACCATTCTAGGTAGTGGG - Intergenic
1109964453 13:69673341-69673363 CAGGCACTGTTCTAGGCAGTGGG - Intergenic
1109968116 13:69728284-69728306 AAGGCACTGTGCTAGGTATTAGG + Intronic
1112253507 13:97806281-97806303 CAGGCACCATTCTAGGCACTGGG + Intergenic
1114392363 14:22323603-22323625 CAGGCACTATGCTAAGTACTGGG - Intergenic
1114503369 14:23188838-23188860 CAGGCACCATTTTAGGTACTGGG - Intronic
1114552768 14:23543184-23543206 CAGGCACCGTGCTAGGCCCTCGG + Intronic
1114650309 14:24280521-24280543 CAGGCACCTTGCTAGGTGAGAGG - Intergenic
1115434766 14:33360129-33360151 CAGGCACTCTGCTGGGAACTCGG - Intronic
1116479348 14:45380022-45380044 CAGGCACTATGCTAGATCGTAGG + Intergenic
1117274750 14:54181488-54181510 AAGGCACCATGCTGGGTACTTGG - Intergenic
1117742199 14:58830381-58830403 CAGGTACCATGCTAGGCACTCGG + Intergenic
1119185344 14:72637498-72637520 CAGGCACTCTTCCAGGTACTGGG + Intronic
1120072448 14:80118866-80118888 CAGGCACTCTTCTAGGAGGTGGG - Intergenic
1120653840 14:87166038-87166060 CAGACACTCTGCTAGGTTCTGGG - Intergenic
1120908476 14:89642892-89642914 CAGGCACTGTGCTAGGTACTGGG - Intergenic
1120941589 14:89955220-89955242 CAGGCACAGTGCTAGGTGCTGGG - Intronic
1121299839 14:92861608-92861630 CAGGCACCCTGCAAGGTGCTGGG - Intergenic
1121575360 14:94980571-94980593 CAGGCACCGTGCTGGGTGCTGGG - Intergenic
1121576071 14:94989261-94989283 CAGCCACTCTGCCAGGTACTGGG + Intergenic
1121718637 14:96094148-96094170 CAGGCACTGTGCTGGGTGGTGGG - Intergenic
1121986091 14:98507406-98507428 CAGGCACTGTGCTAGGCATTTGG + Intergenic
1122181023 14:99954627-99954649 CAGGCACTGTGCTAGGTGATGGG - Intergenic
1122201902 14:100127940-100127962 CAGGCACTGTGCTAGGTGCTGGG - Intronic
1122389563 14:101370985-101371007 CAGGCACCATGCTAGGCACGGGG + Intergenic
1122552669 14:102558418-102558440 CAGGCTCCCTGGTAGGTAGCTGG - Intergenic
1122686453 14:103510213-103510235 CAGGCACTATTCTAGGTACTTGG - Intergenic
1122900160 14:104779098-104779120 CAGGCGCCCTGCTAGGTGGGAGG - Intronic
1124061189 15:26294934-26294956 CAAGCACCCTCCTAGGCACTGGG + Intergenic
1124083330 15:26521354-26521376 CAGCCACCCTCCCAGGTAGTCGG + Intergenic
1124210787 15:27763694-27763716 CAGGCACCCTCCTGGGAAGCAGG + Intronic
1124392766 15:29274583-29274605 CAGGCACTGTGCTAGGTACTGGG - Intronic
1125029976 15:35066504-35066526 CAGGCACTATGCTAGGTCCTAGG - Intergenic
1125166891 15:36716839-36716861 CAGGCACTGTGTTAGGCAGTAGG + Intronic
1126112212 15:45181986-45182008 GAGGCACCCTGCTGGGTGGCAGG - Intronic
1126579231 15:50227784-50227806 CAGGCACCATGGTAGGTGCTGGG - Intronic
1126994977 15:54432140-54432162 CAGGCACTGTGCTAAGTACTTGG + Intronic
1127321062 15:57846966-57846988 CAGGCACCATGCTAGGCACTGGG - Intergenic
1127445868 15:59062533-59062555 CAGGCACTGTTCTAGGCAGTGGG + Intronic
1128310682 15:66630277-66630299 CAGGCACCATGCTAGGTGCTGGG + Intronic
1128770086 15:70275566-70275588 CAGGCTTCCTGCTAGATAGGAGG + Intergenic
1128779829 15:70352024-70352046 CAGGCACTGTGCTAGGTGTTAGG - Intergenic
1128848389 15:70923517-70923539 CAGGCATTGTTCTAGGTAGTTGG + Intronic
1129024375 15:72555765-72555787 CAGGCACTTTGCTAGGTTCTGGG - Intronic
1129139977 15:73588901-73588923 CAGGCACCAGGCTAGGTACTCGG - Intronic
1129435504 15:75536901-75536923 CAGGCACAGTGCTAGGAACTAGG - Intronic
1129999035 15:80031520-80031542 CAGACACCCTGCTAGGTCCTGGG - Intergenic
1130056077 15:80527183-80527205 CAGCCACTTTGCTAGGTCGTGGG + Intronic
1130208173 15:81897832-81897854 CAGGAACTGTGCTAGGTACTAGG + Intergenic
1130558263 15:84938587-84938609 CAGGCATTCTGCTAGGCACTGGG + Intronic
1130614316 15:85390140-85390162 CAGGCACGGTTCTAGGTAATGGG + Intronic
1131370512 15:91877402-91877424 CAGGCACTCTTCTAGATACTGGG + Intronic
1131785235 15:95905201-95905223 CAGGCACCGTGCTAGGCAGTTGG - Intergenic
1131866283 15:96714188-96714210 CAGGCACTATGCTAAGTGGTTGG - Intergenic
1133393447 16:5427625-5427647 AAATCACCCTGCAAGGTAGTTGG + Intergenic
1134013136 16:10869925-10869947 CAGGCCCTGTGCTAGGTATTTGG - Intergenic
1134773590 16:16832369-16832391 CAGGCACCATGCAAGGCACTGGG + Intergenic
1134830671 16:17320241-17320263 CAGGCACTGTGCTAGGTTTTTGG - Intronic
1134856960 16:17528016-17528038 CAGGCACTGTGCTAGGTGCTGGG - Intergenic
1134912053 16:18036413-18036435 CAGGCACTCGTCTAGGCAGTTGG + Intergenic
1135072604 16:19365162-19365184 CAGGCACCATGCTTGGTATTGGG - Intergenic
1135075819 16:19392761-19392783 CAGGCACCATCCTAGGCACTGGG + Intergenic
1135156812 16:20059689-20059711 CAAGCACTCTTCTAGGCAGTGGG - Intronic
1135156986 16:20061132-20061154 CAGGCACCATGCTAGGTACGTGG - Intronic
1135380351 16:21991134-21991156 CAGACACCCAGCTAGGCACTGGG - Intronic
1135829283 16:25759355-25759377 CAGGCACAGTGCTAGGTGCTGGG + Intronic
1135916879 16:26613236-26613258 CAGGCACTGTGCTAGGTATAAGG - Intergenic
1136005180 16:27324462-27324484 CAGGCACCGTGCTAGGCTCTGGG + Intronic
1136181113 16:28553020-28553042 CAGGCACTGTGCTAGGTACTAGG + Intergenic
1137509822 16:49089377-49089399 CTGGCACTATGCTAGGTATTGGG + Intergenic
1137567016 16:49539652-49539674 CAGGCACTGTGCAAGGTGGTGGG + Intronic
1137928259 16:52562374-52562396 CAGGCACCAAGGTAGGTACTGGG + Intergenic
1138114909 16:54352618-54352640 CAGGCACTCTGCTAGGAATTGGG + Intergenic
1138184828 16:54968477-54968499 CAGGCACCGTGTTAGGTGTTGGG - Intergenic
1138496207 16:57410874-57410896 CAGGCACCATGCTTGGTGCTGGG + Intronic
1138772433 16:59681764-59681786 CAGGCACTCTTGTAGGTACTGGG + Intergenic
1139112656 16:63910108-63910130 GAGGCAATCTGCTAGGTATTTGG + Intergenic
1139325908 16:66152420-66152442 CAGGAACCCTGCAAGGAAGGTGG - Intergenic
1139666574 16:68461179-68461201 CAGGCACCATTCTAGGCACTGGG - Intergenic
1139678675 16:68542845-68542867 CAGGCACTTTTCTAGGCAGTTGG + Intronic
1140412972 16:74752652-74752674 CAGGCACCCTGCTTGGTGCTGGG - Intronic
1140728396 16:77834398-77834420 CATGGGCCCTGCTAGGTACTAGG - Intronic
1140808788 16:78557425-78557447 CAGGCACCATTCTAGGTGTTGGG + Intronic
1140912018 16:79462786-79462808 CAGGCACTCTGCTAGGTGCTAGG + Intergenic
1141234146 16:82199869-82199891 CAGGCACCATGCTAGGTGCTGGG + Intergenic
1141401506 16:83751152-83751174 CAGGCACCATGGTAGGTGCTGGG - Intronic
1141648370 16:85379340-85379362 CAGGCACCATTCTAGGCACTGGG - Intergenic
1141868703 16:86769543-86769565 CAGTCACCCTGCTAGTCAGTGGG - Intergenic
1142996437 17:3763369-3763391 CAGGCCCCATGCTAGTTACTAGG + Intronic
1143260570 17:5595540-5595562 CAGGCACTCTGCTGGGCAATGGG - Intronic
1143343442 17:6232107-6232129 CAGACACTGTGCTAGGTACTTGG - Intergenic
1143652841 17:8274795-8274817 CGGGCACTGTGCTAGGTATTAGG - Intergenic
1143708064 17:8714176-8714198 CAAGCACCATTCTAGGCAGTGGG + Intergenic
1144095805 17:11899870-11899892 CAGGCACCCTGCTAGGTCTAAGG + Intronic
1144135582 17:12291823-12291845 CAGGCACTTTGCTAAGAAGTGGG - Intergenic
1144470966 17:15540807-15540829 CAGGCACCATGCTAGCTGCTGGG + Intronic
1145325658 17:21821911-21821933 CAGGCACCATGCTAGGCCCTGGG - Intergenic
1145813559 17:27779928-27779950 CAGGCACTCTGCTAGCTGTTGGG + Intronic
1146228905 17:31091697-31091719 CAGTCACCCTAGTAAGTAGTTGG + Intergenic
1146442788 17:32911639-32911661 CAGGCACCAGGCTAGGTGGTGGG + Intergenic
1146635146 17:34498529-34498551 CAAGCACCATGCTAGGCAGTAGG + Intergenic
1147951072 17:44108373-44108395 CAGGCACTGTGCTAGGTGCTGGG + Intronic
1148704948 17:49621796-49621818 CAGGCACTGTGCTAGGCACTGGG + Intronic
1148798221 17:50207628-50207650 CAGGCACTTTGCTGGGTACTGGG + Intergenic
1148837989 17:50476355-50476377 CAGGCACGCTGCGAGGTAAGGGG - Intergenic
1148843615 17:50515349-50515371 CAGGCACTGTGCTAGGTTCTAGG - Intronic
1149188430 17:54029900-54029922 CAGGGCCACTGCCAGGTAGTCGG - Intergenic
1149585807 17:57785638-57785660 CAGGCACTGTACTAGGAAGTGGG - Intergenic
1149903800 17:60506685-60506707 TAGGCACTGTGCTAGGTATTGGG - Intronic
1150163024 17:62915304-62915326 TAGGCACCCTGCTAGGTACAGGG - Intergenic
1150266536 17:63835682-63835704 CAGGCACCTTGTCAGGTACTGGG + Intronic
1150597175 17:66616510-66616532 CAGGCACCGTGCTAGGCACTGGG + Intronic
1151022225 17:70630734-70630756 CAGGTATCCTGCTAGGTGCTGGG + Intergenic
1152038858 17:77890482-77890504 CAGGCACCCTGCTGGGCATTCGG + Intergenic
1153264378 18:3255096-3255118 CAGGCACTGTGCTGGGCAGTGGG - Intronic
1153446645 18:5180198-5180220 TATGTACTCTGCTAGGTAGTAGG - Intronic
1153962157 18:10149019-10149041 GAGGCACCCTGCAAGGTGATGGG + Intergenic
1155565762 18:27132546-27132568 CAGGCACCATGCTCAGTCGTAGG + Intronic
1156870285 18:41937745-41937767 CAGGCACTCTGCAAGGTCTTAGG - Intergenic
1157500346 18:48186125-48186147 CAGGCACACTGCATGCTAGTTGG + Intronic
1158029836 18:52950002-52950024 CAGGCACTCTGCTAGGTACCAGG + Intronic
1158590655 18:58776056-58776078 CAGGCACTGTGCTAGCTGGTAGG + Intergenic
1161654564 19:5506226-5506248 CAAGCACCATTCTAGGTATTGGG - Intergenic
1162306899 19:9880315-9880337 CAGGCACTGTTCTAGGTACTGGG + Intronic
1163633308 19:18427682-18427704 TGGGCACCCTGCTGGGTGGTGGG + Intronic
1164502264 19:28829957-28829979 CAGGCACTCTGCTGGGTGGCAGG - Intergenic
1166041121 19:40203689-40203711 CAGGCACTGTGCTAGGCACTCGG - Intronic
1166549010 19:43652582-43652604 CAGGCACCGTGCTGGGTGCTGGG + Intronic
1167011936 19:46814163-46814185 CGGGCACCCTGCCAGGGATTGGG + Intergenic
925953465 2:8937818-8937840 CAGGCACTCTGCTAGGCCCTGGG + Intronic
926036304 2:9638494-9638516 CAAGCACTCTGCTAGGCACTGGG - Intergenic
926692438 2:15746723-15746745 CGGGCACTCTGCTAGGGATTTGG - Intergenic
927776199 2:25905456-25905478 CAGGCACCATGCTAGGTACCTGG - Intergenic
927880363 2:26685980-26686002 CAGGCACTCTGCTAGTTCCTAGG + Intergenic
927973266 2:27319191-27319213 CAGATACCTTGTTAGGTAGTAGG - Intronic
928257533 2:29736644-29736666 AAGGCACTCTGCTAGATACTGGG - Intronic
929632619 2:43480436-43480458 CAGGCCCTCTGCTAGTTACTGGG - Intronic
929658087 2:43754516-43754538 CGGACTCCCTGGTAGGTAGTAGG - Intronic
930242949 2:48955132-48955154 CAGGCACCATGCTAGGCAGCAGG - Intergenic
930684716 2:54295710-54295732 CAGGCATCATGCTAGGTGTTGGG + Intronic
931423822 2:62152560-62152582 CAGGCACCATGCTAGGTGCTGGG - Intergenic
932120321 2:69093142-69093164 TGGGTACCCTGCTAGGCAGTGGG - Intronic
932133095 2:69205001-69205023 CAGGCACCAAGCTAGGCAGTGGG + Intronic
932621555 2:73267531-73267553 CAGGCACTGTTCTAGGTATTGGG + Intronic
933865753 2:86515662-86515684 CAGGCACAGTGCTAGGCACTGGG - Intronic
934543866 2:95198564-95198586 CAGCTACCCTGCTAGGAAATGGG + Intergenic
934769225 2:96897256-96897278 CAGGCACGGTGCTAGGTTCTGGG - Intronic
934769777 2:96900374-96900396 CAGGCACCCAGGTGGGTCGTCGG - Intronic
935817614 2:106861458-106861480 CAGGCACTGTGCTAGATGGTGGG + Intronic
936156649 2:110051320-110051342 CAGGCACCATGCTAGGCACTGGG - Intergenic
936168353 2:110144086-110144108 CAGGCACTGTGCTAGATAATGGG - Intronic
936188043 2:110320124-110320146 CAGGCACCATGCTAGGCACTGGG + Intergenic
936287756 2:111194258-111194280 CAGGCACCATTCTAGGCACTAGG + Intergenic
936515932 2:113181632-113181654 CAGGCAGTCTGCTGGGTGGTAGG + Intronic
936708527 2:115103740-115103762 CAGGCACTATTCTAGGTAGAGGG - Intronic
936919163 2:117670118-117670140 CAGGCACCATGCTAGGCACTGGG + Intergenic
936977515 2:118234445-118234467 CAGGCAAAGTCCTAGGTAGTGGG - Intergenic
937065503 2:119013823-119013845 CAGGCACTGTGCCAGGTACTGGG + Intergenic
937069538 2:119052820-119052842 CAGGCACTGTGCTGGGTAGTGGG - Intergenic
937106269 2:119316699-119316721 CAGGCACTGTGCTAGGTATTGGG + Intronic
937908817 2:127065451-127065473 CAGCCCCCCTGCCAGGTAATGGG - Intronic
938127659 2:128686180-128686202 CAGGCACCCTGCAAGGTCTGGGG - Intergenic
938623262 2:133079998-133080020 CAGGCATTGTGCTAGGTATTGGG - Intronic
939305931 2:140411580-140411602 AAGTCACACTGCTAGTTAGTTGG + Intronic
940770708 2:157836700-157836722 CAGGCACCCCGGTAGGGACTGGG - Intronic
942497789 2:176558014-176558036 CAGGTACTATGCTAGGTATTGGG + Intergenic
942977411 2:182035022-182035044 CAGGCACTGGGCTAGGTATTGGG - Intronic
944191587 2:197009789-197009811 AATGCACCCTGCTAGGAAGAAGG - Intronic
944332876 2:198492995-198493017 CAGACACTCTTCTAGGTACTTGG - Intronic
945000236 2:205342208-205342230 CAGGCACTCTGATAGGCATTAGG + Intronic
945201063 2:207281998-207282020 CAGGCACCATGATAGGCACTGGG + Intergenic
945407844 2:209471405-209471427 AAGGCACCATGCTAGGTACTGGG - Intronic
945619173 2:212111758-212111780 CAGGCAGGGTGCTAGGTACTGGG + Intronic
945855367 2:215062959-215062981 CAGGCACCATTCTAGGCACTGGG - Intronic
945935448 2:215898853-215898875 CAGGCACACTTCTAGGCACTTGG - Intergenic
946007852 2:216540859-216540881 CAGGCACTGTGCTAGGCACTGGG - Intronic
946192461 2:218014786-218014808 CAGGTACCATGCTAGGTACTAGG - Intergenic
946305590 2:218855363-218855385 CAGGCTCCCAGCTGGGTAGCGGG - Intergenic
946317576 2:218927773-218927795 CCGGCACTCTGCTAGGTGCTAGG + Intergenic
946728896 2:222689684-222689706 CAGGCACCATGCTGGATACTTGG - Intronic
946745904 2:222845602-222845624 CAGGCACGGTGCTAGGTGCTGGG + Intergenic
947375788 2:229493708-229493730 CAGGCTCCAGGCTAGGTACTGGG + Intronic
948262775 2:236616362-236616384 CAGGCACTGTGCTAGGTACAGGG + Intergenic
948815579 2:240508689-240508711 CAGGCACCATTCTAGGCACTAGG - Intronic
1168786714 20:545541-545563 CAGACACTGTGCTAGGTACTGGG + Intergenic
1169002528 20:2178303-2178325 CAGGCACAATCCTAGGTACTTGG + Intergenic
1170064679 20:12298772-12298794 CAGGCAGCCTGCTTGGGTGTTGG + Intergenic
1170601355 20:17843796-17843818 CAGGCATCCTGCCAGCTACTGGG + Intergenic
1170777920 20:19394666-19394688 CAGCCATCCTACTAGGTAGGAGG - Intronic
1171382377 20:24743369-24743391 CAGGCACCATACCAGGTACTGGG + Intergenic
1172068297 20:32237224-32237246 CAGGCTCTATGCTAGGTACTGGG + Exonic
1172336150 20:34117694-34117716 CAGGCACTCTGCTAGGTGCTGGG - Intergenic
1172434407 20:34918899-34918921 CAGGCACTTTGCTAGGTGTTGGG + Intronic
1172641237 20:36441597-36441619 CAGGCACTGTGCCAGGTACTGGG - Intronic
1172824173 20:37766400-37766422 CAGGCACTGTGCTAGGTACTAGG + Intronic
1173637798 20:44576235-44576257 CAGGCACTCTTCTAGGCACTTGG + Intronic
1173665067 20:44757391-44757413 CAAGAACCCTGCTAGGCACTGGG + Intronic
1174039733 20:47690364-47690386 CAGGCACCCTGCTAGGCACTGGG + Intronic
1174058548 20:47816383-47816405 CAGGTACTCTGCTAGGTGCTGGG - Intergenic
1174159732 20:48542261-48542283 CAGGCACTCTGCTAAGTTCTGGG + Intergenic
1174179119 20:48663965-48663987 CAGGCACCGTGCCAGGTTCTGGG - Intronic
1174220999 20:48955481-48955503 CAGGCACCATTCTAGGTGTTGGG - Intronic
1174364462 20:50048137-50048159 CAAGCACCATGCTAGGCACTGGG - Intergenic
1174413762 20:50353445-50353467 CAGGCACTGTGCTGGGTGGTGGG + Intergenic
1174470784 20:50759154-50759176 CAGGCTCCCTGCCAGGTGGTTGG - Intergenic
1174869440 20:54169351-54169373 CTGGCACTGTGCTAGGTACTAGG - Intronic
1175337271 20:58204870-58204892 CAGGCACCCTGCTCTGTGGATGG - Intergenic
1175353901 20:58346739-58346761 CAGGCACCATGCTAGGCCCTGGG - Intronic
1178522388 21:33297335-33297357 CAGGCACTGTGTTAGGTACTAGG + Intergenic
1181099864 22:20531927-20531949 CAGGCAATGTGCCAGGTAGTAGG + Intronic
1181257669 22:21574382-21574404 CAGGCACTCTTCTAAGCAGTTGG - Intronic
1181628949 22:24140404-24140426 CAGGCACCAAGCTAGGTGGTAGG + Intronic
1181910607 22:26235413-26235435 CAGACACATTGCTAGGTACTAGG + Intronic
1181932318 22:26412167-26412189 TAGGCACAGTGCTAGGTACTAGG - Intergenic
1182189709 22:28446193-28446215 CAGGCACTGTTCTAGGCAGTAGG - Intronic
1183114795 22:35682692-35682714 AAGGCACCCTGCAATGCAGTAGG - Intergenic
1183133428 22:35862626-35862648 CAGGTACTCTGCTAGGTATTAGG - Intronic
1183201024 22:36386268-36386290 CAGGGACTCTGCCAGGTGGTGGG - Intronic
1183416579 22:37686127-37686149 CAGGCACAGTCCTAGGCAGTGGG + Intronic
1184666191 22:45990347-45990369 CCAGCACCCTGCTGGGTAGATGG - Intergenic
1184887287 22:47354132-47354154 CAGACACCCTGCTAGGCACCAGG - Intergenic
949299567 3:2568033-2568055 CAGGCACGGTGCTAGGTGCTGGG - Intronic
949477354 3:4461038-4461060 CATGCACCATGCTAGGCAGTGGG - Intronic
949694410 3:6677957-6677979 CAGACACTCTTCTAGGTGGTGGG + Intergenic
949909158 3:8886599-8886621 CAGGCACAGTGCTAGGTGCTAGG + Intronic
950350648 3:12347845-12347867 CAGGGACTCTGCTAGGTTCTAGG + Intronic
950455929 3:13092778-13092800 CAGGAACCCTGCAAGGTGGGTGG - Intergenic
950586582 3:13896350-13896372 CAGGCACTGTTCTAGGCAGTGGG + Intergenic
950646090 3:14377708-14377730 CAGGCACCATGCTAGGCCTTGGG - Intergenic
950760439 3:15219182-15219204 CAGGCACTCTGCTGGGTACTTGG - Intronic
951451455 3:22844002-22844024 CAGGCACCATGCTAAGTGTTAGG - Intergenic
951596833 3:24327550-24327572 CAGGCACAATTCTAGGTACTTGG + Intronic
951629862 3:24707892-24707914 AAGGCACTCTCCTAGGTACTGGG + Intergenic
952102528 3:30031349-30031371 CAGGCACTGTGCTAGGAACTGGG - Intergenic
952486962 3:33822287-33822309 CAGGCACTGTGCTAGGTGCTCGG - Intronic
952858385 3:37792259-37792281 CAGGCACTGTGCTAGGCACTGGG + Intronic
953031416 3:39182338-39182360 GAGGAACCATGCTAGGTAGAGGG - Intergenic
953156518 3:40380114-40380136 CAGGCACTGTGCTAGATACTGGG - Intergenic
953646182 3:44757548-44757570 CAGGCACTGTGCTAGGTGCTGGG + Intronic
955180468 3:56663952-56663974 CAGGCACAGTTCTAGGTAATAGG + Intronic
955611935 3:60766794-60766816 CAGGTACTGGGCTAGGTAGTAGG + Intronic
955841061 3:63113257-63113279 CAGACACTGTACTAGGTAGTGGG + Intergenic
955945799 3:64192269-64192291 CAGGCACTATGCTAGGTGCTGGG + Intronic
955953980 3:64269170-64269192 CAGGCCCCATGCCAGGTACTAGG + Intronic
956264629 3:67383112-67383134 CAAGCACGGTGCTAGGTATTAGG - Intronic
956853970 3:73257764-73257786 CAAGGTCCCTGCCAGGTAGTAGG + Intergenic
958148035 3:89652913-89652935 CAGGCACCCTTCCAGGTAACGGG + Intergenic
959373317 3:105557243-105557265 CTGGCAGCCTGCTAGGTCATGGG - Intronic
959867723 3:111290646-111290668 CAGGAACCCTGCAAGCTAGAAGG - Intergenic
960115847 3:113891359-113891381 CAGGCACAGTGCTAGGTGCTTGG + Intronic
960143258 3:114171780-114171802 CAGGCTCACTACTAAGTAGTTGG + Exonic
960624910 3:119673283-119673305 CAGGCACTGTTATAGGTAGTGGG + Intronic
961589072 3:127961747-127961769 CAGGCACTGGGCTAGGTACTAGG + Intronic
961926599 3:130487955-130487977 CAGGCACCATCCTGGGTACTGGG - Intergenic
962733548 3:138304449-138304471 CAGACACCCTGATGGGGAGTAGG + Intronic
963296464 3:143551805-143551827 CAAGCACCATGCTAGCTACTAGG - Intronic
964155657 3:153581988-153582010 CAGGCACTGTTCTTGGTAGTGGG - Intergenic
964376787 3:156055773-156055795 CAGGCACCATTCTAGGTACTGGG - Intronic
964423983 3:156532911-156532933 CTGGCATCGTGCTAGGCAGTGGG + Intronic
964646411 3:158962894-158962916 CAGGCACCATGCTAGGTGCTGGG + Intronic
964851362 3:161099695-161099717 CAGGCACTATGCTAGGTGCTGGG - Intronic
964887259 3:161498729-161498751 CAAGCACCCTGCAAGGTGTTAGG - Intronic
965509737 3:169555257-169555279 CAGGCACTCTGCTAAGGACTAGG + Intronic
965570714 3:170169224-170169246 CAGGTAACCAGCTAGGTAGTTGG - Intronic
965597682 3:170424175-170424197 CAGACACCATGGTAGGTACTGGG + Intronic
965754373 3:172010451-172010473 CTGGCACTCTTCTAGGTACTGGG - Intergenic
965754610 3:172012935-172012957 CAGACACTCTGCTAGGTGCTGGG - Intergenic
965987027 3:174766756-174766778 CAGGCATTATTCTAGGTAGTTGG + Intronic
966770375 3:183498723-183498745 CAGGCACAGTGCTAGGTACAGGG + Intronic
966943679 3:184762457-184762479 CAGGCACTCTACTAGGTACCAGG - Intergenic
967080087 3:186041989-186042011 TAGGAACCCTGCCAGGTAGCTGG - Intergenic
967144153 3:186591982-186592004 CAGGCACTGTGCTAGGTGCTGGG + Intronic
967197276 3:187039367-187039389 CAGGCACTGTGCTGGGTACTAGG + Intronic
967527615 3:190513423-190513445 CAGGCACTGTGCTAGGCAATGGG + Intergenic
968010718 3:195272342-195272364 TAGGCACCGTGTTAGGTACTGGG - Intergenic
968844125 4:3030477-3030499 CAGGCACCGTCCTAGGCATTGGG + Intronic
969079516 4:4607712-4607734 CAATCACCGTGCTAGGCAGTGGG + Intergenic
969090278 4:4688893-4688915 CAGGCACCGTGCTAGGCAACGGG - Intergenic
969096005 4:4733514-4733536 CAGGCACTCTGCTAGGCACAAGG - Intergenic
969235598 4:5863278-5863300 CAGCAACCCTGCAAGGTAGGAGG + Intronic
969289315 4:6228501-6228523 CTGGCACCATGCTAGGTGCTGGG + Intergenic
969646113 4:8430265-8430287 CAGGTACCCTGCTAAGCAGTCGG + Intronic
969906759 4:10404275-10404297 TCGGCACCCAGCTAGGAAGTGGG - Intergenic
970133281 4:12894378-12894400 CAGGCACCATGCTAGGCACAGGG - Intergenic
970499256 4:16660590-16660612 CAGGCACCTTGCTAGGTTCTGGG + Intronic
970606860 4:17689412-17689434 TAGGCACCATGCTAGGTACAAGG + Intronic
972277111 4:37567731-37567753 CAGGCACTGTGCTAGGTTCTGGG - Intronic
972549748 4:40119716-40119738 CAAGCATCATGCTAGGTAATGGG + Intronic
972598864 4:40554085-40554107 CAGGCACCGTGCTGGGTCCTGGG - Intronic
973223133 4:47751795-47751817 CAGGCACACTGCTAGATGCTGGG - Intronic
973637370 4:52872535-52872557 CAGGCACTGTGCTAGGTTCTGGG - Intergenic
973778335 4:54264467-54264489 CAGGCACTGTGCTAGGTTCTGGG + Intronic
974026013 4:56733736-56733758 CAGGCACTCTGCTAAGTGCTGGG + Intergenic
975294097 4:72712151-72712173 CAGGCACCGTCCTTGGCAGTGGG - Intergenic
975975912 4:80096645-80096667 CAGGCAGCATGCCAGGTACTGGG - Intronic
975990205 4:80251288-80251310 CAGGCATTATGCTAGGTAATGGG + Intergenic
976831368 4:89318470-89318492 CTGGCACTCTTCTAGGTACTTGG + Intergenic
977286711 4:95116894-95116916 CAGGCAACATGCTAGGTATTAGG + Intronic
977318735 4:95483957-95483979 CAGGCACCATTCTAGGCATTAGG + Intronic
978292262 4:107155521-107155543 CAGGCATTGTGCTAGCTAGTGGG - Intronic
978758160 4:112326454-112326476 CAGGCACCATGCTAGGTAGGTGG - Intronic
978992868 4:115107726-115107748 CAGGCACCATGCAAGTTACTAGG - Intronic
979167082 4:117548069-117548091 CAAGCACACTTCTAGGTACTAGG - Intergenic
979464260 4:121018121-121018143 CAGGCACCATGCTAGGTAATGGG - Intergenic
979485838 4:121269410-121269432 CAGGCACTGTGCTAAGTATTAGG + Intergenic
979486132 4:121272233-121272255 CAGGCACTGTGCTAGGAACTTGG - Intergenic
979653247 4:123161133-123161155 CAGGCACTCTGCTAAGTTTTTGG - Intronic
979717996 4:123864736-123864758 CAGGCAGTGTGCTAGGTACTAGG - Intergenic
980486570 4:133464456-133464478 CAGGCACTCTGCTAGGGGCTGGG - Intergenic
981046736 4:140271764-140271786 CAGGCACTGTGCTAGGTGATAGG + Intronic
981603051 4:146512679-146512701 CTGGCACCATTCTAGGTACTTGG + Intronic
982114753 4:152088870-152088892 CAGGCACTGTGCTAGGTGCTGGG + Intergenic
983642652 4:169957438-169957460 CAGGCACCATGGTTGGCAGTAGG + Intergenic
983861321 4:172710940-172710962 CAGGCACTCTTATAGGTACTGGG + Intronic
984904250 4:184611992-184612014 CAGGCATTGTGCTAGGTACTGGG - Intergenic
985062901 4:186095872-186095894 CAGTCACCCTTCTAGATAGTGGG - Intergenic
987776318 5:22372324-22372346 CAGGCAGCCTGCTTGGCAGCTGG + Intronic
987846548 5:23294755-23294777 CAGAAACCCTACTAGGTAGAAGG - Intergenic
988716308 5:33831981-33832003 CAGGGTCCCTGCAAGGTAGCTGG + Intronic
988878253 5:35472058-35472080 CAGGCTGCCTGCTAGGCACTGGG + Intergenic
990281394 5:54254623-54254645 CAGGCACCAGGCTAGGTGCTAGG - Intronic
990411060 5:55542032-55542054 AAGGAACCATGGTAGGTAGTGGG - Intergenic
990546164 5:56823507-56823529 CAGGCATCCTGCTAGGTGCTAGG - Intronic
990775084 5:59297648-59297670 CAGGCACTGTTCTAGGTACTGGG - Intronic
991116115 5:62957576-62957598 CAGGCACTATTCTAGGTATTGGG + Intergenic
991240833 5:64458350-64458372 TAGGCACTCTTCTAGGCAGTGGG - Intergenic
991253256 5:64586691-64586713 GAGGCACTCTGCTAGGTGCTAGG - Intronic
991716410 5:69454896-69454918 CAGGCACTGTGCTAGCTATTGGG + Intergenic
991990736 5:72336444-72336466 CAGGCACTGTGTTAGGTGGTGGG - Intronic
992408173 5:76479246-76479268 CAGGCCCCGTGCAAGGCAGTGGG - Intronic
992533068 5:77671018-77671040 CAGGCACCATGCTAGGCTCTGGG - Intergenic
992673884 5:79085963-79085985 CTGGCACCCTGATAGGAAGCCGG + Intronic
992738826 5:79752157-79752179 CAGGCATTGTGCTAGGTACTGGG - Intronic
992776398 5:80092927-80092949 CAGGCACTGTGCTAGATACTGGG + Intergenic
993085839 5:83362952-83362974 CAGGCACGCTGCTAGGCACTGGG + Intergenic
993447676 5:88034124-88034146 CAGGCACTGTGCTTGGTAGTAGG + Intergenic
993447683 5:88034207-88034229 CAGGCATTGTGCTTGGTAGTAGG + Intergenic
994874958 5:105409293-105409315 AAAGCACCATGCTAGGTAATTGG + Intergenic
995798817 5:115969314-115969336 CAGGCAGCCTAATAGGTAATTGG - Intronic
996439103 5:123469594-123469616 CAGGCACTTTGCTAGGTGCTAGG + Intergenic
997426103 5:133803724-133803746 CAGGCACTATGCTAGGCACTGGG + Intergenic
997741775 5:136261268-136261290 CAGGCACCGTGTCAGGTACTAGG - Intronic
997806756 5:136925536-136925558 CAGGCAGTATGCTAGGTACTGGG + Intergenic
997826421 5:137110798-137110820 CAGGCACTGTGCTAGGTGCTGGG - Intronic
998818985 5:146041451-146041473 TAGGCACCGTGCTAGGCACTGGG - Intronic
999893424 5:156003295-156003317 CAGGCACACTGCTACGTGCTGGG - Intronic
999928102 5:156401639-156401661 CAGGCACTGTGCAAGGTACTGGG + Intronic
1000037606 5:157460636-157460658 CAGACACCCTGAGAGGTGGTGGG + Intronic
1000257298 5:159552153-159552175 CAGGCACCATGCTAGTTCCTGGG + Intergenic
1000293875 5:159896089-159896111 CAGGCACTGTGCTAGGTCCTGGG - Intergenic
1001164946 5:169356028-169356050 CAGGCTCTCTGCTAGGTTCTGGG + Intergenic
1001446272 5:171786237-171786259 CAAGCACCATGCTAGGCACTAGG - Intronic
1001560871 5:172668230-172668252 CAGGCACCATGCCAGGCACTGGG - Intronic
1003626016 6:7741933-7741955 AAGGCACCATGCTAGGCACTTGG - Intronic
1004433781 6:15570093-15570115 CAGGCACTCTGCTGGTTAGCAGG - Intronic
1004585860 6:16999451-16999473 CAGACACTCTGCTAGGCACTTGG + Intergenic
1005486165 6:26301911-26301933 CAGCCACTGTGCTAGGTACTGGG + Intergenic
1005976238 6:30802072-30802094 CAGGCATCATGCTAGGCTGTAGG + Intergenic
1006626824 6:35403590-35403612 CAGGCACCGTGCCAGGTGCTGGG + Intronic
1006733009 6:36250600-36250622 TAGGCACCATTCTAGGTATTAGG + Intronic
1006925444 6:37651831-37651853 CAGGCACTGTGCTAGGTCCTGGG - Intronic
1007026659 6:38582933-38582955 CAGGCACCATGCAAGGTATCGGG + Intronic
1008651623 6:53569719-53569741 CTGGTACCGTGCTAGGTACTGGG + Intronic
1010403941 6:75481264-75481286 CAGGCACCGAGCTAGGGATTGGG - Intronic
1010443692 6:75927772-75927794 CAGGCACCCTGCTAGATGCTGGG - Intronic
1011536672 6:88383019-88383041 CATGCACCTTGCTAGGTATTTGG + Intergenic
1012497350 6:99848570-99848592 CAGATACTGTGCTAGGTAGTGGG + Intergenic
1013003014 6:106043371-106043393 CAGGCACTGTGCTAAGCAGTGGG - Intergenic
1013018798 6:106189018-106189040 CAGGTACCATGCTAGGCACTGGG - Intronic
1013118786 6:107123232-107123254 CAGGCACAGTGCTAGGCACTTGG - Intergenic
1013482053 6:110561389-110561411 CATGCACCATACTAGGTACTGGG + Intergenic
1013818430 6:114126780-114126802 CAGGCACCCTGCTGGGCTGGTGG + Intronic
1014221145 6:118799991-118800013 CAGGCACTGTGCTAGGCACTGGG - Intergenic
1014457889 6:121657963-121657985 CAGGCACTATGCTAGGGACTTGG - Intergenic
1015008574 6:128314346-128314368 CAGGCACCCTTCTGGGTGCTGGG - Intronic
1016327944 6:142924358-142924380 CAGGCACCGTTCTAGGCATTAGG + Intronic
1016915210 6:149238155-149238177 CAGGCACCGTGCTGGGTGTTGGG - Intronic
1016991853 6:149935614-149935636 CAGGCACTGTGCTAGGTGCTGGG - Intergenic
1018039001 6:159905194-159905216 CAGGCACTGTGCTAGGCACTGGG - Intergenic
1018562709 6:165118795-165118817 CAGGCAGCGGGCTAGGAAGTGGG + Intergenic
1018892651 6:167993821-167993843 CCGAGACCCTGCTAGGTAGGAGG + Intergenic
1021906312 7:25337504-25337526 CAGGCACTTTGCTAGGCACTGGG + Intergenic
1022478933 7:30730364-30730386 CAGGCACTGTGCTAGGCATTGGG + Intronic
1022557661 7:31315609-31315631 CAGGCACCTTGGTGGTTAGTAGG - Intergenic
1022570519 7:31448744-31448766 CAGGAACCCTGCTTGGTGGAGGG + Intergenic
1022606353 7:31818427-31818449 CAGGCACCATGCTAAGCACTGGG - Intronic
1022806302 7:33825846-33825868 CAGGCACTGTGCTGGGTGGTAGG + Intergenic
1023124397 7:36940775-36940797 CAGGCTCTCTGCTAGGCACTGGG + Intronic
1024292601 7:47815735-47815757 CAGGCACTCTTCTAGGCACTGGG + Intronic
1024525509 7:50345588-50345610 CAGGCACTCTGCTAGGCAGAGGG + Intronic
1024565109 7:50674172-50674194 AAGGCACTGTGCTAGGTAGAGGG - Intronic
1024698281 7:51879052-51879074 CAGGCACCCTGCTATGATGGAGG - Intergenic
1024720335 7:52129473-52129495 AAGGCACCCTGTTAAGTCGTTGG + Intergenic
1025231957 7:57208381-57208403 CAGGCAACCCCCTAGGCAGTGGG - Intergenic
1026173452 7:67974730-67974752 CTGACACCCTGCTAGTTAGGAGG - Intergenic
1026379511 7:69784886-69784908 CAGGCACCCTTCTAGGTACTGGG + Intronic
1026585916 7:71656120-71656142 CAGGCACAGTGCTGGGCAGTAGG + Intronic
1028167707 7:87557331-87557353 CAGGCACTGTGCTAGGTTCTAGG - Intronic
1028482534 7:91323313-91323335 CAGGCACCATGCTAGGTACCAGG + Intergenic
1029308872 7:99642818-99642840 CAAGCACCATTCTAGGTAGTGGG - Intergenic
1029647271 7:101865790-101865812 CAGGCACAATGGTAGGTAGTGGG + Intronic
1029982121 7:104888597-104888619 CAGGCATTCTGCTAGGTCATGGG + Intronic
1030082418 7:105789292-105789314 CAGGCACTGTGCTAGGTGCTGGG + Intronic
1030715759 7:112804996-112805018 CAGGAACCTTGTTAGGAAGTAGG + Intergenic
1030717804 7:112831056-112831078 TAGGCACTCTTCTAGGTACTGGG + Intronic
1030729625 7:112971220-112971242 CAGGTACTGTTCTAGGTAGTTGG + Intergenic
1032868287 7:135952117-135952139 CAGGCACTGTGCTAGACAGTAGG + Intronic
1033191798 7:139288149-139288171 CAGGCACTCTTCTAGGTGCTGGG + Intronic
1034724232 7:153320379-153320401 CAGGGACCCTGCCAGGTACAAGG + Intergenic
1035148021 7:156840167-156840189 CAGGCACTCTTCTAGGAACTGGG + Intronic
1035201671 7:157271610-157271632 TACGCACCGTGCTAGGTAATGGG + Intergenic
1035607178 8:937665-937687 CTGGCACCCAGCGAGGCAGTTGG - Intergenic
1037575604 8:20199292-20199314 CAGGCACTGTGCTAGGCAGTGGG - Intronic
1037575721 8:20200365-20200387 CAGGCACTGTGCTAGGCAGTGGG - Intronic
1038529673 8:28308166-28308188 CAGGCACCATGCTAGGGGCTGGG - Intergenic
1039425048 8:37478627-37478649 CAGGCACTGTGCTAGGTACTGGG + Intergenic
1039842655 8:41304791-41304813 CAGGGACCCTGTTTGGAAGTAGG - Intronic
1039949948 8:42162545-42162567 CAGGCACTGTGCTGGGTACTGGG + Intronic
1039993841 8:42514041-42514063 CAAGCACCATGCTAAGGAGTGGG + Intronic
1040317612 8:46273203-46273225 CAGGCACCCTGCTCCAAAGTCGG - Intergenic
1040336449 8:46418476-46418498 CAGGCACCCTGCTCCAAAGTTGG - Intergenic
1041173933 8:55173612-55173634 CTGGCACTGTGCTAGGCAGTGGG - Intronic
1041331418 8:56729530-56729552 CAGGCACCATTCTAGGCACTGGG - Intergenic
1042165690 8:65943663-65943685 AAGGCACCATGCTAGGTAATGGG - Intergenic
1042866810 8:73363708-73363730 GAGGCACCCTGCTAGGAGGCTGG + Intergenic
1042945323 8:74148378-74148400 CAGGCACTATGCTAGATACTAGG - Intergenic
1043011109 8:74883082-74883104 CAGGCACTATTCTAGGAAGTGGG - Intergenic
1043018386 8:74969679-74969701 AAGGCACTGTGCTAGGTAATGGG + Intergenic
1043251327 8:78077411-78077433 CAGTCTCCCTTCTAAGTAGTTGG - Intergenic
1044428386 8:92080707-92080729 CAGGCACTGTGCTAGGCACTGGG - Intronic
1044473327 8:92597647-92597669 CAGCAACTCTGCTAGGTACTTGG - Intergenic
1044618286 8:94164386-94164408 GAGGCACCATGCAAGGTACTGGG - Intronic
1044694374 8:94908169-94908191 CAGGCACAATGCGAGGTACTGGG - Intronic
1044739568 8:95312532-95312554 CAGGCATCGTGCTAAGCAGTGGG + Intergenic
1044747647 8:95386169-95386191 CAGGCACTGTGCTAGGTATCAGG - Intergenic
1044868733 8:96597811-96597833 CAGGCACCATTCTAGGTTCTAGG + Intronic
1045406004 8:101867381-101867403 CAGGCACTGTGCTAGGTCCTGGG - Intronic
1046331313 8:112718838-112718860 CAGGCACTGTGTTAGGTAATGGG - Intronic
1046986590 8:120395221-120395243 CAGGCACAGTGCTAGGTCCTGGG - Intronic
1047050370 8:121105049-121105071 CAGGCACTGTGCTAGGAACTAGG - Intergenic
1047066731 8:121292190-121292212 CAGGTACTTTGCTAGCTAGTGGG + Intergenic
1047351457 8:124078558-124078580 CAGGCACACTGCTAAGTGCTGGG + Intronic
1047386041 8:124410176-124410198 CAGGCACTAGGCTAGGTACTGGG - Intergenic
1047388925 8:124434171-124434193 CAGGCACTGTGTTAGGTAATGGG - Intergenic
1047517727 8:125569625-125569647 CAGGCACCGTGCTAGGAGCTGGG - Intergenic
1047725951 8:127684108-127684130 CAGGGCCCCTGCTAGGTACTAGG + Intergenic
1047739120 8:127793281-127793303 CAGGCACCCAGCTAGGCAATGGG - Intergenic
1047828950 8:128610888-128610910 CAGGCACTGTGCTAAGTTGTAGG + Intergenic
1048211929 8:132461593-132461615 CAGGCACCCTGGAAGGCAGTGGG - Intronic
1048688567 8:136932847-136932869 CAGGCACTGTGCTAGGCATTGGG - Intergenic
1049198905 8:141330364-141330386 CAGGCACTATGCTAGGACGTGGG + Intergenic
1049587259 8:143437817-143437839 CTGGCACCCTGGAAGGTGGTGGG + Exonic
1049719208 8:144107887-144107909 CGGGCATCCCGCTAGGAAGTGGG + Intronic
1050158199 9:2690299-2690321 CAGGTACCCTGCTTTGTAATTGG - Intergenic
1051577396 9:18632637-18632659 CAGGCTCCATGCTAGGTACTAGG - Intronic
1052028196 9:23598382-23598404 CAGGCACCATTCTAGGTACTGGG + Intergenic
1052200508 9:25773004-25773026 CAAGCACTCTGCTTGGAAGTGGG - Intergenic
1052839226 9:33277254-33277276 CAGGTACTCTACTAGGTGGTGGG + Intronic
1055058315 9:72043774-72043796 CAAGAACCCTGCTAGGTACCAGG - Intergenic
1055161776 9:73138358-73138380 CAGGCACTGTGCTAGGAAATGGG + Intergenic
1057514438 9:95709665-95709687 CTGGCACTATGCTAGGTACTAGG - Intergenic
1057868945 9:98703401-98703423 CAGGCAGCATGCTGGGCAGTGGG + Intronic
1058467155 9:105240752-105240774 CAGGCACCCAGCTAGGTATTTGG + Intergenic
1058536735 9:105968536-105968558 CAGGCACTGTGCTAGATACTGGG - Intergenic
1058723770 9:107783189-107783211 CAGGCACAATGCTAGGCACTAGG - Intergenic
1059030335 9:110686617-110686639 CAGGCACACTTCTAGTTACTTGG - Intronic
1059710795 9:116865923-116865945 CAGGCACAATGCTAGGTGCTGGG + Intronic
1060080586 9:120640520-120640542 CAGGCACTGTGCTAGGCACTGGG - Intronic
1060235874 9:121862391-121862413 CAGGCACCATGCTGGGTTCTTGG - Intronic
1060418996 9:123454176-123454198 CAGGCACCCTGCTGGGTACTGGG - Intronic
1060484589 9:124039137-124039159 CAGGCCCTCTGCTGGGCAGTGGG + Intergenic
1060790205 9:126480774-126480796 CAGGCACCCTGTCATGTAGGTGG + Intronic
1061504587 9:131024745-131024767 CAGGCACCTTGCTAGGCACTGGG + Intronic
1061858042 9:133453919-133453941 CAGGCAGCCTGCAAGGGAGCTGG - Intronic
1186158876 X:6755415-6755437 CAGACACCTTGCCAGGTACTAGG + Intergenic
1186794178 X:13028639-13028661 CAGGCACGGTGCTAGGCACTGGG + Intergenic
1187254787 X:17632556-17632578 CAGGCACCGTTCTAGGCACTTGG + Intronic
1187397811 X:18933417-18933439 CAGGCACCAGGCTAGCTACTGGG - Intronic
1187422793 X:19150796-19150818 CAGGTACCATGCTAGGTTCTGGG + Intergenic
1187537591 X:20157255-20157277 CAGGCATTCTGCTAGGCACTGGG + Intronic
1187781079 X:22825685-22825707 CAGGCACCATGGTAGCTATTAGG - Intergenic
1188054834 X:25528722-25528744 CAGGCACAATTCTAGGTACTTGG - Intergenic
1188267168 X:28091557-28091579 CAGGCACCGTGCTAGGCACTGGG - Intergenic
1189412439 X:40784680-40784702 CAGGCATGATGCTAGGTAGTGGG + Intergenic
1189722437 X:43933918-43933940 CAGGCACTCTTCTAGGTGCTGGG - Intergenic
1190483694 X:50902985-50903007 CAGGCACTATGCTAGGCACTGGG - Intergenic
1190711594 X:53075503-53075525 CAGGCACTGTTCTAGGTATTGGG - Intronic
1191742478 X:64450509-64450531 CAGGCACTGTGCTAGTTACTGGG - Intergenic
1192033302 X:67538017-67538039 CAGGCACTCTGCTAGACACTGGG - Intergenic
1192225865 X:69227433-69227455 CAGGCCCTCTGCTAGGTGCTGGG + Intergenic
1192773781 X:74221094-74221116 CAGGCACTGTGCTGGGTAGTGGG - Intergenic
1193761687 X:85474818-85474840 CAGGCACTGTGCTAGGTACTGGG - Intergenic
1193821703 X:86173199-86173221 CAGGCACTCTTCTAGGTGCTTGG + Intronic
1194592313 X:95814534-95814556 CAGGCACTATGCTAGGCACTGGG + Intergenic
1195156592 X:102129355-102129377 CAGGCACTGTGCTAGGTATTGGG - Intergenic
1195230896 X:102845776-102845798 CTGGCACCATGCTAGGCACTGGG - Intergenic
1195484678 X:105390404-105390426 CAGGCACCGTGCTAGATGATGGG - Intronic
1195504442 X:105641323-105641345 CAGGCACTCTGCTAGGTAAGGGG + Intronic
1195718979 X:107847709-107847731 CAAGCACCCGGATAGGTATTAGG + Intronic
1196758583 X:119179391-119179413 CAGGCACCATGGTAGGTACCAGG + Intergenic
1196960030 X:120991246-120991268 CAGGCACCATTCTAGGTGTTTGG - Intergenic
1197618700 X:128722412-128722434 CAGGCACTATGTTAGGTAGAAGG - Intergenic
1197821513 X:130545309-130545331 CAGGGACCATGCTATGTAGAAGG - Intergenic
1197860904 X:130969132-130969154 AAGGCACTGTGCTAGGTATTTGG + Intergenic
1197862320 X:130984100-130984122 CAGGCACTGTGCTAGGCATTGGG + Intergenic
1197865130 X:131009439-131009461 CAGGCACTGTGCTAGGTCCTAGG + Intergenic
1197917104 X:131547671-131547693 CAGGCACTATGCTAGGTATTAGG + Intergenic
1198068636 X:133125436-133125458 CAGGCACTCTTCTAGGCACTAGG - Intergenic
1198210545 X:134511984-134512006 CAGGCATTCTGCTTGGGAGTTGG + Intronic
1198659119 X:138947778-138947800 CAGTCACCCTCCGAGGTACTGGG - Intronic
1198735966 X:139785651-139785673 CAGGCACAGTGCTAGGTGCTGGG + Intronic
1199435271 X:147805631-147805653 AAGGCACCCTGACAGGTAGCTGG - Intergenic
1199510949 X:148621773-148621795 CAGGTACTCTGCTAGGTGCTGGG + Intronic
1199523246 X:148761740-148761762 CAGGCACTATGCTAGGCATTTGG - Intronic
1200011949 X:153126353-153126375 CAGGCACCCTGCGAGGTTACAGG - Intergenic
1200027652 X:153273566-153273588 CAGGCACCCTGCGAGGTTACAGG + Intergenic
1202304773 Y:23457123-23457145 CAGGCACCATGCTCGGTATTAGG + Intergenic
1202566037 Y:26213468-26213490 CAGGCACCATGCTCGGTATTAGG - Intergenic