ID: 1068931447

View in Genome Browser
Species Human (GRCh38)
Location 10:62594476-62594498
Sequence CCAGGCACCCTGCTAGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 0, 2: 12, 3: 102, 4: 613}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931447_1068931454 4 Left 1068931447 10:62594476-62594498 CCACTACCTAGCAGGGTGCCTGG 0: 1
1: 0
2: 12
3: 102
4: 613
Right 1068931454 10:62594503-62594525 CGGCTGATGCTCTGGGTCTGTGG No data
1068931447_1068931452 -4 Left 1068931447 10:62594476-62594498 CCACTACCTAGCAGGGTGCCTGG 0: 1
1: 0
2: 12
3: 102
4: 613
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931447_1068931453 -3 Left 1068931447 10:62594476-62594498 CCACTACCTAGCAGGGTGCCTGG 0: 1
1: 0
2: 12
3: 102
4: 613
Right 1068931453 10:62594496-62594518 TGGCTCTCGGCTGATGCTCTGGG No data
1068931447_1068931455 12 Left 1068931447 10:62594476-62594498 CCACTACCTAGCAGGGTGCCTGG 0: 1
1: 0
2: 12
3: 102
4: 613
Right 1068931455 10:62594511-62594533 GCTCTGGGTCTGTGGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931447 Original CRISPR CCAGGCACCCTGCTAGGTAG TGG (reversed) Intronic
901299570 1:8189606-8189628 CCAGGCACTGTGTTAGGCAGTGG + Intergenic
901464549 1:9413027-9413049 CCAGGCACCGTGCTGGGCACTGG + Intergenic
901749074 1:11395041-11395063 CCAGGAACTCTGCTAGGCATTGG + Intergenic
902067014 1:13696919-13696941 CCAGACACTCTTCTGGGTAGTGG + Intergenic
902148985 1:14426963-14426985 CCAGGCACAGAGCTAGGTACTGG + Intergenic
902651492 1:17840498-17840520 GGAGTCACCCTGCTAGGAAGTGG - Intergenic
902804407 1:18851862-18851884 ACAGGCACCCAGCTAGGGAGTGG - Intronic
903163443 1:21505209-21505231 GCAGGCACCCTTCTAGGAACTGG - Intergenic
903239519 1:21973724-21973746 CCAGGCTCCCTTCTAGGTACTGG + Intergenic
903243321 1:21998650-21998672 CCAGGCTCCCTTCTAGGTACTGG + Intergenic
903303964 1:22399751-22399773 CCAGGCACGGTGCTAGGCACTGG + Intergenic
903369109 1:22823795-22823817 CCAGGCACTATGCTAGGTGCTGG - Intronic
903692328 1:25183419-25183441 CCAGGCACCATGCTAAGTCTTGG + Intergenic
903820886 1:26101692-26101714 CCAGGCACCGTGCTAGGCACTGG - Intergenic
904374607 1:30072566-30072588 GCAGGCACCCTTCTAGGCAAAGG + Intergenic
904754703 1:32761719-32761741 CCAGGCACCATGCCAGGTCGTGG - Intronic
904847217 1:33429701-33429723 CCAGGCACTCTGCTATGTCTTGG - Intronic
904850855 1:33458347-33458369 CCAGGCACTGCGCTAGGTGGTGG - Intergenic
905317297 1:37091334-37091356 CCAGGCACTCTACTAGGTGCTGG - Intergenic
905338461 1:37261607-37261629 CCAGGCATTCTGCTAGGCACTGG - Intergenic
905590933 1:39162847-39162869 CCAGGCACTATGCTAGGTAAAGG - Intronic
905998128 1:42399850-42399872 CCAGGCAGCATGCTAGGCACTGG + Intronic
906169507 1:43712460-43712482 CCAGGCTCTGTGCTAGGTGGTGG + Intronic
906211079 1:44012572-44012594 CCAGGCACTGTGCCAGGAAGTGG + Intronic
906265125 1:44422984-44423006 CCAGGCACCATGCGAGGTACTGG + Intronic
906283274 1:44568458-44568480 CCAGGCACTGTGCTAGGGATGGG - Intronic
906325572 1:44843351-44843373 CCCGGCCCGCTGCTAGGTAACGG + Intergenic
906820323 1:48922586-48922608 CCAGGCACCATACTAGGCACCGG + Intronic
906937042 1:50223528-50223550 CCAGGCACTCTTCTAGGCACAGG + Intergenic
907189325 1:52635120-52635142 CCAGGCACTTTGCAAGGTATTGG + Intronic
907734787 1:57101705-57101727 CCAGGCACTCTGCTAGGCACTGG + Intronic
907899020 1:58720494-58720516 CCAGGCACTCTTTTAGGTACTGG - Intergenic
908332883 1:63088092-63088114 CCAGGCACGTTGCTAGGTAACGG + Intergenic
908395152 1:63718675-63718697 CCAGGCACTGTGCTAGACAGTGG + Intergenic
908637214 1:66180857-66180879 CCAGGCACAGTGCTAGATAGTGG - Intronic
908765568 1:67551954-67551976 CCAGGCATCGTGCTAGGTACTGG - Intergenic
909763667 1:79326708-79326730 CCAGGCATTCTGATAGGTATAGG + Intergenic
910042231 1:82866740-82866762 AAAGTCACCCTCCTAGGTAGAGG - Intergenic
910109405 1:83666829-83666851 CCAGGCACTCTGCTAGGAACTGG - Intergenic
910113999 1:83712532-83712554 CAAGTCACCCTGCATGGTAGTGG - Intergenic
910158909 1:84252819-84252841 CCAGGCACTATGCTAGGCACTGG + Intergenic
910482818 1:87676846-87676868 CCAGGCACAGTTCTAGGTACTGG - Intergenic
910934318 1:92475197-92475219 CCAGGCACCATGCTAGGTATTGG - Exonic
911441522 1:97932837-97932859 CCAGGCACCATTCTAGGTGTAGG - Intergenic
911489278 1:98542366-98542388 CCAGGAACTCTTCTAGGCAGTGG + Intergenic
911525425 1:98979105-98979127 CCAGGCATTCTTCTAGGTACTGG + Intronic
911648571 1:100361520-100361542 CCAGGCACAGTGCTAGGTGTTGG - Intronic
912164506 1:107026844-107026866 CCAGGCACTCTTCTAGGTCCTGG + Intergenic
912376739 1:109215530-109215552 CCAGGTACAGTGCTAGGTACTGG - Intronic
912695756 1:111840901-111840923 CCAGGCACTGTTCTAGGCAGAGG + Intronic
912869628 1:113292147-113292169 CCAGGCACTGTGCTAGGTACTGG - Intergenic
913054179 1:115142209-115142231 CCAGGTACCATGCTAGGCACTGG - Intergenic
913224374 1:116686067-116686089 GCAGGCACCATGCTAAGGAGAGG + Intergenic
913235997 1:116784030-116784052 TCAGGCACCATGCTAAGTACTGG - Intergenic
914140102 1:144938758-144938780 CCAGGCACTGTGCTAGGCACTGG - Intronic
914691775 1:150035663-150035685 CCAAGAACAGTGCTAGGTAGGGG + Intergenic
914763228 1:150615953-150615975 CCAGCCACTCTACTAGGTGGTGG - Intronic
915065402 1:153220424-153220446 TCAGGCACCATGCCAGGTACTGG + Intergenic
915160272 1:153914602-153914624 ACAGGCACCATGCTAGGCAATGG + Intronic
915281188 1:154823152-154823174 CCAGACACCCTGATTTGTAGAGG - Intronic
915391992 1:155552132-155552154 CCAGGCACTATTCTAGGTACTGG - Intronic
915908758 1:159899396-159899418 ACAGTCACCTTGCTAGTTAGTGG + Intronic
916014018 1:160732526-160732548 CCAGGCACTCTTCTAGTTACTGG + Intergenic
916432494 1:164744608-164744630 CCAGGCACTCTTCTAGCTACTGG - Intronic
916959581 1:169875561-169875583 CCAGGCACTATTCTAGGTAGAGG + Intronic
917122059 1:171653057-171653079 CCAGGCACTATGCTAGGAACTGG + Intergenic
918302131 1:183214229-183214251 TCAGGCACCATGCTGGGCAGTGG + Intronic
918321263 1:183367115-183367137 CCAGGCACCATGCTAGGATGTGG - Intronic
919844354 1:201631896-201631918 CCAGGCACTGTGCTAGGTGATGG - Intronic
920295974 1:204956663-204956685 CCAGGCACTGTGCTAGGTGCTGG - Intronic
920484790 1:206359626-206359648 CCAGGCACTGTGCTAGGCACTGG + Intronic
920651514 1:207840738-207840760 CCAGGCACCATTCTAGGTACTGG - Intergenic
921323960 1:213972355-213972377 CAGGGCACCGTGCTAGGTAATGG + Intergenic
921397886 1:214688248-214688270 CAAGGCACCATGCTAGGTGCTGG + Intergenic
921838561 1:219803644-219803666 CCAGGCAGCATGCCAGATAGAGG + Intronic
921940896 1:220838571-220838593 CCAGGCACCTTGCTAGATGCTGG + Intergenic
921971098 1:221150063-221150085 CCAGGAACTGTGTTAGGTAGTGG + Intergenic
922643676 1:227262980-227263002 CCTAGCACCCTGTGAGGTAGAGG + Intronic
922795503 1:228337661-228337683 CCAGGCACCCTGTTAGGGCTTGG + Intronic
923070911 1:230563511-230563533 CCAGGCACTGTGCTAGGTGTGGG - Intergenic
923999501 1:239534976-239534998 CCAGGCACTGTGCTAGGTGCTGG + Intronic
924429932 1:243988237-243988259 CCAGCCTCCCTGCCAGGAAGAGG - Intergenic
924531613 1:244898640-244898662 CCAGGCACTCTACTAGGTGCTGG - Intergenic
924587231 1:245370871-245370893 CCAGGCACTGTGCTAGGTGGTGG + Intronic
1063629791 10:7722901-7722923 CCAGGCGCCCTGCTAACCAGCGG - Intronic
1063820482 10:9829297-9829319 CCAGACACTATGCTAGGTACTGG - Intergenic
1065122726 10:22544432-22544454 CCAGGCACCGTGCTAGGCTTGGG - Intronic
1065152448 10:22836130-22836152 CCAGGCACTTTGCTTGGTATTGG + Intergenic
1065376565 10:25049284-25049306 CTAGGCACTTTGCTAGGTACTGG + Intronic
1066065040 10:31755790-31755812 CCAGGCACTGTTCTAGGTACCGG + Intergenic
1066648241 10:37632449-37632471 CCAGGCACTGTGCTAAGTACTGG - Intergenic
1067079622 10:43205717-43205739 CCAGGCCACCTGCTAGCTGGTGG + Intronic
1067408982 10:46048288-46048310 CCAGGCACCCTGCTGGTCACTGG - Intergenic
1068931447 10:62594476-62594498 CCAGGCACCCTGCTAGGTAGTGG - Intronic
1069082278 10:64101191-64101213 CCAGACACACCGCTAGGTAGAGG + Intergenic
1070719005 10:78743580-78743602 CCTGGCACCCTGCAAGGTCACGG + Intergenic
1070808891 10:79287371-79287393 CCAGGCACAATGATGGGTAGTGG - Intronic
1070941754 10:80354523-80354545 TCAGGCACCATGATAGGTACTGG + Intronic
1071369096 10:84933112-84933134 CCAGGCACACAGCTAAGTAACGG - Intergenic
1071467568 10:85955473-85955495 ACAGAGACCCTCCTAGGTAGGGG - Intronic
1071904867 10:90161708-90161730 CCAGGCACTGTGCTAGGAATTGG + Intergenic
1072191478 10:93080082-93080104 CCAAGGACCTTGCTAGGTAAAGG - Intergenic
1072640564 10:97208034-97208056 CCAGGCACCCTGCTAAGCCAGGG + Intronic
1073307193 10:102512431-102512453 CCAGTCTACCTGCTAGGTATAGG + Intronic
1073585482 10:104705920-104705942 CCCAGCACCCCTCTAGGTAGAGG - Intronic
1073637889 10:105218406-105218428 CAAGGCACTCTGCTAGGCACTGG + Intronic
1073992229 10:109275167-109275189 CCAGGCAACATGACAGGTAGAGG - Intergenic
1074462450 10:113650716-113650738 CCAGGCACTGTGCTGGGTATTGG - Intronic
1074826327 10:117217634-117217656 CCAGGCACGCTCCTACGGAGAGG - Intergenic
1074910609 10:117905283-117905305 TCAGGCACTCTGCTAGGCACTGG + Intergenic
1075633549 10:124015688-124015710 CCAGGCACCCTGCTAGGCAATGG + Intronic
1075636815 10:124035360-124035382 CCAGGGTCCCTGTTAGGGAGTGG - Intronic
1076634955 10:131875879-131875901 CCAGCCTCCCTGCAAGGGAGGGG - Intergenic
1077268828 11:1665712-1665734 CCAGGGCCCCTGCTGGGAAGAGG + Intergenic
1077271925 11:1685468-1685490 CCAGGGCCCCTGCTGGGAAGAGG - Intergenic
1077594563 11:3520656-3520678 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
1078509585 11:11975594-11975616 CCAGGCACCCTCCTGAGCAGAGG + Intronic
1078736495 11:14025376-14025398 CCAGGCACAATGCTAGGTGCTGG + Intronic
1079033019 11:16999551-16999573 CCAGGCTCCCTCCTGGGTAACGG + Intronic
1080349613 11:31368835-31368857 CCAGGTACAATGCTAGGAAGAGG + Intronic
1080792338 11:35532973-35532995 CCAGGCACTATTCTAGGCAGTGG + Intergenic
1080834027 11:35923170-35923192 CCAGGCACCACGCTAGGCACAGG - Intergenic
1080950729 11:37029696-37029718 CCAGGCACCATGCTAGGCCCTGG - Intergenic
1081431428 11:42980649-42980671 CCAGACACCATGCTAAGTAAGGG + Intergenic
1081604235 11:44517391-44517413 CCAGGCACCCAGCAAGGTCTGGG + Intergenic
1081665406 11:44914192-44914214 CCAGGCACTGTGCTAGGTATTGG - Intronic
1081840684 11:46199290-46199312 CCAGGCAGCGTCCTAGGTACTGG + Intergenic
1083347367 11:62003005-62003027 CCAGACACCCTTCTAGGTACTGG - Intergenic
1084095189 11:66906700-66906722 CCAGGCTCCCTGCCAGGTCATGG - Intronic
1084250409 11:67893927-67893949 CCAGGCACTGTGCTTGGTGGTGG - Intergenic
1084475698 11:69387401-69387423 CCAGGCACTGTGCTAGGTGCTGG - Intergenic
1085062492 11:73460436-73460458 CCAGTCACTGTGCTAGGTACTGG + Intronic
1086141249 11:83503011-83503033 CCAGGCACTGTGCTAGGAACTGG + Intronic
1086330663 11:85750621-85750643 CCAGGCTCCGTGCTAGGTGCTGG - Intronic
1087664909 11:101032848-101032870 CCAGTCACTCTGCTAGATTGTGG - Exonic
1087672239 11:101121771-101121793 CCAGGCACTATGTTAGGTACTGG - Intronic
1088786394 11:113186074-113186096 CCAGGCACTATGCTGGGTATTGG + Intronic
1089084102 11:115802355-115802377 CCAGACACTCTGCTAGGAACTGG - Intergenic
1089104885 11:115994235-115994257 CCAGGCACTGTGCTAGGTCCTGG + Intergenic
1089332092 11:117696674-117696696 TCAGGCACCCTGCTAAGCACTGG - Intronic
1089410077 11:118233635-118233657 CCAGTCACCCAGCTAGTGAGTGG - Intronic
1089765313 11:120758894-120758916 CCAGGCACTGTGCTAGGCACTGG + Intronic
1090267963 11:125365907-125365929 CCAGGCACCGTGCTGGGCACTGG - Intronic
1090441205 11:126727102-126727124 CCAGGCTCCATGCTAGGCACTGG - Intronic
1091009597 11:131986768-131986790 TCAGGCACTCTTCTAGGCAGTGG - Intronic
1091393444 12:139426-139448 CCTGGCGCCCTGCTTGGTGGAGG - Intronic
1091475467 12:768050-768072 CCAGGCACCCTACTACATAGAGG + Intronic
1091731867 12:2886974-2886996 CCAGGCATTCTGCTAGGTGCTGG + Intronic
1092420737 12:8329445-8329467 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
1092864839 12:12751146-12751168 CCAGGAACCCTGGTAGGCAATGG - Intronic
1092894301 12:12998264-12998286 CCAGGCACTCTTCTAGGCAATGG - Intronic
1092934321 12:13346525-13346547 CCAGGCACTATGCTAGGTACTGG - Intergenic
1093718263 12:22408776-22408798 CCAGGCACACTGCCAGTAAGTGG + Intronic
1093993145 12:25612596-25612618 TCAGGCACCATGCTAGATACTGG - Intronic
1094630234 12:32166679-32166701 TCAGGCACTGTGCTTGGTAGAGG - Intronic
1095263535 12:40126227-40126249 CGAGGCACCCTGCTAGGGGAAGG + Intergenic
1095486221 12:42687392-42687414 CCAGGCACTGTGCTAGGCAATGG + Intergenic
1095834812 12:46626003-46626025 CCAGGCACCGTTCTAGGTTTTGG + Intergenic
1095962740 12:47845611-47845633 CCAGGCACTATGCTAGGTACTGG - Intronic
1096314623 12:50553381-50553403 CCAGGCACTGCGCTAGGTACTGG - Intronic
1096539386 12:52296471-52296493 GCAGGCACCCAGCTGGTTAGTGG + Intronic
1096584661 12:52612047-52612069 CTAGGCACTATGCTAGGTACTGG - Intronic
1096604548 12:52755196-52755218 CCAGGCACTGTGCTAGGCAATGG - Intergenic
1097298063 12:57988789-57988811 CCAGGCACTGTTCTAGGTAGTGG + Intergenic
1097580710 12:61453542-61453564 CCAGGCACTATGCTAGGTGTCGG + Intergenic
1098017570 12:66122279-66122301 CCAGGCACACTGCTAAATTGGGG - Exonic
1098055900 12:66504870-66504892 CCAGGCACATTGCTAGGCATTGG + Intronic
1098419738 12:70282058-70282080 CCAAGCACCAAGCTAGGTATTGG - Intronic
1099149321 12:79089434-79089456 CCAGGTACCATGCTAGGCAGAGG - Intronic
1099248908 12:80228049-80228071 CCAGGCACTGTTCTAGGTACTGG - Intronic
1099320259 12:81138292-81138314 CCAAGCACTGTGCTAGGTATAGG + Intronic
1099543746 12:83950089-83950111 CCATGCACTGTTCTAGGTAGTGG + Intergenic
1100731087 12:97470368-97470390 CCAGGCACCGTGCTAGGCAGTGG - Intergenic
1101180698 12:102213785-102213807 CCAGGCACTCTACTAGGCACTGG + Intergenic
1101194931 12:102372062-102372084 CCAGGCACTGTGCTAGGTGCTGG + Intergenic
1101440810 12:104703151-104703173 CCAGGCACTGTGCTAGGTGCAGG - Intronic
1101521243 12:105484329-105484351 CCAGGCACTTGGCTAGGTATGGG + Intergenic
1101763644 12:107679490-107679512 CCAGGCACTCTGCCAGGTGTTGG + Intergenic
1101812343 12:108118856-108118878 CCAGGCACTCAGCTAAGTAATGG - Intergenic
1101816268 12:108148354-108148376 CCAGGCCCCTTTCTAGGTACTGG - Intronic
1101871767 12:108571551-108571573 CAAGGCACACAGCTAGGAAGTGG + Intergenic
1101879015 12:108613903-108613925 CCCGGCACCCAGCTCTGTAGAGG + Intergenic
1102041696 12:109805198-109805220 CCAGGCACTGTGCTTGGCAGAGG - Intronic
1102222907 12:111206623-111206645 TCAGGCACAGTGCTAGGTACTGG - Intronic
1102229950 12:111255727-111255749 CCAGGCACTGTGCTATGTACTGG - Intronic
1102469409 12:113151131-113151153 CCAGGCACCCTTGTAGGCACTGG - Intronic
1102522643 12:113488289-113488311 CTAGGCACTCTGCTAGGGACAGG + Intergenic
1102689042 12:114746176-114746198 CCAGGCACCATGCTAGGGGCTGG + Intergenic
1103070618 12:117938201-117938223 TCAGGCACCGTGCTGGGTACTGG - Intronic
1103103016 12:118196848-118196870 CCAGGCACTATTCTAGGTATTGG + Intronic
1103235579 12:119369787-119369809 CCAGGCCCCGTGCTAGGTACTGG - Intronic
1103423633 12:120811743-120811765 CCAGGCACTCTGCTAGCCACTGG + Intronic
1103861012 12:124014000-124014022 CCAGGCACTGTGCTAGGTGCTGG + Exonic
1103887419 12:124213176-124213198 CCAGACACCATGCTGGGTACTGG - Intronic
1104172467 12:126295672-126295694 CCAGGCACTCTGCTAAGTAATGG - Intergenic
1105579647 13:21683312-21683334 CCAGGCACTGTGCTAGGAACTGG - Intronic
1105645083 13:22309080-22309102 CCAGGCACTTTGCTAGGCAATGG + Intergenic
1106197604 13:27507650-27507672 CCAGGCACTCTGCTAGGTGTTGG - Intergenic
1106693101 13:32140473-32140495 CCAGGCACAGTTCTAGGTACTGG + Intronic
1107317665 13:39150947-39150969 CCAGGCTCTCTGCTAGGCACTGG + Intergenic
1107797966 13:44073974-44073996 TCAGGCACCATTCTAGGTAGTGG - Intergenic
1109205834 13:59481777-59481799 TCATGCACCTTGCTAGGTAGTGG + Intergenic
1109964454 13:69673342-69673364 CCAGGCACTGTTCTAGGCAGTGG - Intergenic
1110094848 13:71504898-71504920 CCAGGCACCATTCAAGGTATAGG - Intronic
1110665987 13:78117910-78117932 CCAGGCACTGTGCTAAGTATAGG - Intergenic
1111486535 13:88908963-88908985 GGAGGCACCCTGCCAGATAGTGG + Intergenic
1112244660 13:97720774-97720796 CCAGGCACTGTGCTAGTCAGTGG + Intergenic
1112253506 13:97806280-97806302 CCAGGCACCATTCTAGGCACTGG + Intergenic
1112353822 13:98658362-98658384 CCAGTCACCATGCAAGGGAGTGG + Intergenic
1114239793 14:20856058-20856080 CCAGGCAGACCGCTAGGTACTGG + Intergenic
1114392364 14:22323604-22323626 CCAGGCACTATGCTAAGTACTGG - Intergenic
1114503370 14:23188839-23188861 CCAGGCACCATTTTAGGTACTGG - Intronic
1114627763 14:24140697-24140719 CCAGGCACTATGCTGGGTACTGG - Intronic
1114686301 14:24535015-24535037 CCAGGCACTGTGCTAGGCACTGG - Intergenic
1116785590 14:49284756-49284778 CCAGGCACTGTGCTAAGTACTGG - Intergenic
1117484633 14:56181991-56182013 CCAGGCATCATGCCAGGTATTGG + Intronic
1117674959 14:58146127-58146149 CCAGGCACATTGCCAGGAAGGGG - Intronic
1117696259 14:58367485-58367507 CCAGGCACTCTGCCAGGTGGCGG + Intronic
1118372695 14:65151075-65151097 CCAGGCATCATGCTAGGTGCTGG + Intergenic
1118860732 14:69661103-69661125 CCAGGCACCAGGCTAGGTCCTGG - Intronic
1120179371 14:81328133-81328155 CCAGGCACTGTGCTTGGTATGGG - Intronic
1120653841 14:87166039-87166061 CCAGACACTCTGCTAGGTTCTGG - Intergenic
1120678369 14:87449759-87449781 GCAGGCACTCTGCCAGGTATTGG + Intergenic
1120908477 14:89642893-89642915 TCAGGCACTGTGCTAGGTACTGG - Intergenic
1120939601 14:89934581-89934603 CCAGGCACTCTGGTAGGTGAGGG - Intronic
1120941590 14:89955221-89955243 CCAGGCACAGTGCTAGGTGCTGG - Intronic
1121299840 14:92861609-92861631 CCAGGCACCCTGCAAGGTGCTGG - Intergenic
1121576070 14:94989260-94989282 CCAGCCACTCTGCCAGGTACTGG + Intergenic
1121718638 14:96094149-96094171 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
1122142728 14:99672517-99672539 CCAGGCACAGTGCTAGGCACAGG - Intronic
1122181024 14:99954628-99954650 CCAGGCACTGTGCTAGGTGATGG - Intergenic
1122201903 14:100127941-100127963 CCAGGCACTGTGCTAGGTGCTGG - Intronic
1122389562 14:101370984-101371006 TCAGGCACCATGCTAGGCACGGG + Intergenic
1123037337 14:105476889-105476911 CCAGGTGGCCTACTAGGTAGAGG - Intronic
1124061188 15:26294933-26294955 CCAAGCACCCTCCTAGGCACTGG + Intergenic
1124099774 15:26682613-26682635 CAAGTCACCCTGCTAGTTAGGGG - Intronic
1124392767 15:29274584-29274606 CCAGGCACTGTGCTAGGTACTGG - Intronic
1125895413 15:43297946-43297968 CCAGGCTCCTTTCTAGGCAGGGG - Intronic
1126579232 15:50227785-50227807 CCAGGCACCATGGTAGGTGCTGG - Intronic
1127321063 15:57846967-57846989 CCAGGCACCATGCTAGGCACTGG - Intergenic
1128310681 15:66630276-66630298 CCAGGCACCATGCTAGGTGCTGG + Intronic
1128315939 15:66659449-66659471 CCAGGCTCCCTGTCAGGGAGAGG - Intronic
1128331729 15:66760610-66760632 CCAGACACACAGCTAGGAAGTGG + Intronic
1128770209 15:70276495-70276517 CCAGGAACCCAGCCAGGTTGCGG + Intergenic
1129024376 15:72555766-72555788 CCAGGCACTTTGCTAGGTTCTGG - Intronic
1129999036 15:80031521-80031543 TCAGACACCCTGCTAGGTCCTGG - Intergenic
1130056076 15:80527182-80527204 CCAGCCACTTTGCTAGGTCGTGG + Intronic
1130334512 15:82947829-82947851 CCAGGCACTGTGCTAGGTGTTGG + Intronic
1130558262 15:84938586-84938608 CCAGGCATTCTGCTAGGCACTGG + Intronic
1130915664 15:88302656-88302678 CCAGGCACCGTGCTAAGTGTGGG - Intergenic
1131131944 15:89905904-89905926 CCAGGAGCACTGCTGGGTAGAGG - Intronic
1132212451 15:100034478-100034500 CCAGGCATCCAGCCTGGTAGTGG - Intronic
1132840420 16:1976116-1976138 TGAGGCACCCTGAGAGGTAGGGG + Intronic
1134301905 16:12999620-12999642 CCATGCAACCTGCTAGGTCAAGG - Intronic
1134331232 16:13252786-13252808 CCAGGTACCGTGGTAGGTGGAGG - Intergenic
1134773589 16:16832368-16832390 CCAGGCACCATGCAAGGCACTGG + Intergenic
1135072605 16:19365163-19365185 CCAGGCACCATGCTTGGTATTGG - Intergenic
1135075818 16:19392760-19392782 CCAGGCACCATCCTAGGCACTGG + Intergenic
1135156813 16:20059690-20059712 CCAAGCACTCTTCTAGGCAGTGG - Intronic
1135610622 16:23863717-23863739 CCAGGAACCCTGATTGGAAGCGG - Intronic
1135829282 16:25759354-25759376 CCAGGCACAGTGCTAGGTGCTGG + Intronic
1135961840 16:27001383-27001405 CCAGGCACCATGCTAGTTGCTGG - Intergenic
1136005179 16:27324461-27324483 CCAGGCACCGTGCTAGGCTCTGG + Intronic
1136088569 16:27902707-27902729 CAAGGCACCCTGCTGGTAAGCGG - Intronic
1136412878 16:30086941-30086963 CCAGGGACCCTGTCAGGTAGGGG + Intronic
1136460152 16:30405375-30405397 CCCGTCACCCTTCTAGGTATGGG - Intergenic
1137400444 16:48148938-48148960 CCAGGGACTATGCTAGGTATTGG - Intronic
1137600711 16:49754329-49754351 CCAGGCACTGTGCTAGGCATCGG - Intronic
1137730181 16:50683905-50683927 CCAGGCCCTCTGCTGGGCAGGGG - Intergenic
1138114908 16:54352617-54352639 CCAGGCACTCTGCTAGGAATTGG + Intergenic
1138184829 16:54968478-54968500 CCAGGCACCGTGTTAGGTGTTGG - Intergenic
1138496206 16:57410873-57410895 CCAGGCACCATGCTTGGTGCTGG + Intronic
1138531486 16:57636760-57636782 CCAGGCACTGTGCTAGGTACTGG + Intronic
1139666575 16:68461180-68461202 CCAGGCACCATTCTAGGCACTGG - Intergenic
1140412973 16:74752653-74752675 CCAGGCACCCTGCTTGGTGCTGG - Intronic
1140497314 16:75400453-75400475 CCAGGAACCTTTCGAGGTAGAGG + Intronic
1140971135 16:80013850-80013872 CCAGGCACAGTTCTAGGCAGGGG + Intergenic
1141148000 16:81545319-81545341 CCAGGCACCATGCTAGGCGCTGG - Intronic
1141234145 16:82199868-82199890 TCAGGCACCATGCTAGGTGCTGG + Intergenic
1141648371 16:85379341-85379363 CCAGGCACCATTCTAGGCACTGG - Intergenic
1141868704 16:86769544-86769566 ACAGTCACCCTGCTAGTCAGTGG - Intergenic
1142214221 16:88822871-88822893 CCAGGGACGCTGCTAGGCACAGG - Intronic
1143260571 17:5595541-5595563 CCAGGCACTCTGCTGGGCAATGG - Intronic
1143708063 17:8714175-8714197 CCAAGCACCATTCTAGGCAGTGG + Intergenic
1144470965 17:15540806-15540828 CCAGGCACCATGCTAGCTGCTGG + Intronic
1144517083 17:15926202-15926224 CCAGGCACCCTGCCAGTTGCTGG + Intergenic
1145813558 17:27779927-27779949 CCAGGCACTCTGCTAGCTGTTGG + Intronic
1146442787 17:32911638-32911660 CCAGGCACCAGGCTAGGTGGTGG + Intergenic
1147041525 17:37722968-37722990 CCTGGGAACCTGCCAGGTAGAGG - Intronic
1147363071 17:39943555-39943577 GCAGCCACCCAGGTAGGTAGGGG + Intronic
1147814240 17:43197125-43197147 GGTGCCACCCTGCTAGGTAGGGG - Intronic
1147951071 17:44108372-44108394 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1147952305 17:44114017-44114039 CCAGGCCCCATGCTAGGTGTTGG + Intronic
1148075137 17:44931393-44931415 CTAGGCAGCCAGCTATGTAGAGG + Intronic
1148285957 17:46391808-46391830 CCAGGCACTGTGCTAGGTGCAGG - Intergenic
1148308121 17:46609429-46609451 CCAGGCACTGTGCTAGGTGCAGG - Intronic
1148390017 17:47265011-47265033 CCAGGCACTCTCCTAGGCACTGG - Intronic
1148704947 17:49621795-49621817 CCAGGCACTGTGCTAGGCACTGG + Intronic
1148724433 17:49778296-49778318 CCAGGCATCATGCTAGGTGCTGG + Intronic
1148798220 17:50207627-50207649 CCAGGCACTTTGCTGGGTACTGG + Intergenic
1148837990 17:50476356-50476378 GCAGGCACGCTGCGAGGTAAGGG - Intergenic
1149350345 17:55780353-55780375 CCAGGCCCACTGCCAGGCAGTGG + Intronic
1149400704 17:56293258-56293280 CCAGGCACCATGTTAGGCACAGG + Intronic
1149585808 17:57785639-57785661 CCAGGCACTGTACTAGGAAGTGG - Intergenic
1149610762 17:57956213-57956235 CCAAGCACCCTGCTACCTAGGGG + Intergenic
1149903801 17:60506686-60506708 CTAGGCACTGTGCTAGGTATTGG - Intronic
1150163025 17:62915305-62915327 CTAGGCACCCTGCTAGGTACAGG - Intergenic
1150266535 17:63835681-63835703 CCAGGCACCTTGTCAGGTACTGG + Intronic
1150597174 17:66616509-66616531 CCAGGCACCGTGCTAGGCACTGG + Intronic
1150649683 17:67001625-67001647 CCAGGCACCATGCTAGGCCCTGG - Intronic
1151022224 17:70630733-70630755 CCAGGTATCCTGCTAGGTGCTGG + Intergenic
1151563000 17:74880800-74880822 CCAGGCACTATGCTAGGTCTAGG - Intronic
1153326912 18:3830128-3830150 CCAGGCACCTTGCTAGGTGCTGG - Intronic
1153338987 18:3955139-3955161 CCAGGCAGCCTGGTAGGAATAGG - Intronic
1153392882 18:4582826-4582848 CCAGGCACTCTTCTTGGTACTGG - Intergenic
1153620030 18:6968514-6968536 CCGGGCCCTCTGCTAGGTACCGG - Intronic
1155193249 18:23449987-23450009 CCAGCCACCATGCTAGGCACTGG + Intergenic
1157257245 18:46150191-46150213 CCACACACCAGGCTAGGTAGAGG - Intergenic
1157521714 18:48349895-48349917 CCAGGCACTGTGCTAGGTGCAGG - Intronic
1157637199 18:49170227-49170249 CCAGGCACACAGCTAAGTGGTGG + Intronic
1157713936 18:49869573-49869595 CCAGGCCCCATGCTTGGCAGTGG + Intronic
1159830365 18:73270655-73270677 CTAGGCACTCTGGTAGGTACTGG + Intergenic
1159893714 18:73977166-73977188 CCAGGAGCCATGCTAGGAAGTGG + Intergenic
1160311405 18:77794456-77794478 CCAGGTACCCTGCTAGGTGCTGG + Intergenic
1160565696 18:79785538-79785560 CCAGGCTCCCTGGCAGGCAGCGG - Intergenic
1160613451 18:80107234-80107256 CCAGGCACCGTGCTGGGTATTGG - Intergenic
1160710540 19:549170-549192 CCAGGCTCCCTGCAAGGTGAGGG + Exonic
1161319192 19:3633218-3633240 CCAGGCCCCCTGCCAGGGACTGG + Intronic
1161513681 19:4684989-4685011 CTCGGGACCCTGCTAGGGAGGGG + Intronic
1161571514 19:5033206-5033228 CCAGGCACCATTCTAGGCACTGG + Intronic
1162306898 19:9880314-9880336 CCAGGCACTGTTCTAGGTACTGG + Intronic
1163381318 19:16970884-16970906 CCAGGCACCCCCCCAGGTAACGG - Exonic
1163633307 19:18427681-18427703 CTGGGCACCCTGCTGGGTGGTGG + Intronic
1164661827 19:29980169-29980191 CCAGGCATCCTTCAAGCTAGTGG + Intronic
1166275353 19:41749883-41749905 CCAGGGACTGTGCTAGGCAGTGG - Intronic
1166280377 19:41788680-41788702 CCAGGGACTGTGCTAGGCAGTGG - Intergenic
1166412340 19:42564231-42564253 CCAGGGACTGTGCTAGGCAGTGG + Intergenic
1166549009 19:43652581-43652603 CCAGGCACCGTGCTGGGTGCTGG + Intronic
925953464 2:8937817-8937839 CCAGGCACTCTGCTAGGCCCTGG + Intronic
926036305 2:9638495-9638517 CCAAGCACTCTGCTAGGCACTGG - Intergenic
926802160 2:16668106-16668128 CCAGGCACTGTGCTAAGTAATGG + Intergenic
927566228 2:24115721-24115743 CTAGGCACTGTGCTAGGTACTGG + Intronic
928401003 2:30978761-30978783 CCAGGCACCGTGCTAGGCTCAGG + Intronic
929632620 2:43480437-43480459 CCAGGCCCTCTGCTAGTTACTGG - Intronic
929925267 2:46202278-46202300 CCAGCAACCCTGCAAGGCAGGGG - Intergenic
930186750 2:48419017-48419039 CCAGGCACCCTTATAGGTGCTGG - Intergenic
930680042 2:54247837-54247859 CCAGTCACCCAGCCAGGTGGTGG - Intronic
930684715 2:54295709-54295731 CCAGGCATCATGCTAGGTGTTGG + Intronic
930921051 2:56754432-56754454 CCAGGCATCCTGCCAGTTTGGGG - Intergenic
931255376 2:60567581-60567603 CCAGGCACTCTCCTAGGCTGAGG + Intergenic
931265868 2:60660049-60660071 CCAGGCACTGTGCTAGGTGCAGG + Intergenic
931423823 2:62152561-62152583 CCAGGCACCATGCTAGGTGCTGG - Intergenic
932120232 2:69091997-69092019 CCAGGCACTGTGCTAGGTGCTGG + Intronic
932120322 2:69093143-69093165 CTGGGTACCCTGCTAGGCAGTGG - Intronic
932133094 2:69205000-69205022 GCAGGCACCAAGCTAGGCAGTGG + Intronic
932621554 2:73267530-73267552 CCAGGCACTGTTCTAGGTATTGG + Intronic
934769226 2:96897257-96897279 CCAGGCACGGTGCTAGGTTCTGG - Intronic
935054307 2:99552417-99552439 CAAGGCACTCTGCTAGGTGCAGG + Intronic
935817613 2:106861457-106861479 CCAGGCACTGTGCTAGATGGTGG + Intronic
936156650 2:110051321-110051343 CCAGGCACCATGCTAGGCACTGG - Intergenic
936168354 2:110144087-110144109 CCAGGCACTGTGCTAGATAATGG - Intronic
936188042 2:110320123-110320145 CCAGGCACCATGCTAGGCACTGG + Intergenic
936708528 2:115103741-115103763 TCAGGCACTATTCTAGGTAGAGG - Intronic
936919162 2:117670117-117670139 CCAGGCACCATGCTAGGCACTGG + Intergenic
937065502 2:119013822-119013844 CCAGGCACTGTGCCAGGTACTGG + Intergenic
937069539 2:119052821-119052843 CCAGGCACTGTGCTGGGTAGTGG - Intergenic
937106268 2:119316698-119316720 CCAGGCACTGTGCTAGGTATTGG + Intronic
938127660 2:128686181-128686203 CCAGGCACCCTGCAAGGTCTGGG - Intergenic
938623263 2:133079999-133080021 CCAGGCATTGTGCTAGGTATTGG - Intronic
939040856 2:137188044-137188066 CCAGGCACCATGCTAAGTGTTGG - Intronic
939429840 2:142089072-142089094 CCAGACACCCTTCTAGGCACTGG + Intronic
939620479 2:144412903-144412925 CCAGGCACTATGCTAGGTGCTGG - Intronic
941165050 2:162075057-162075079 CCAGCCTCCCTTCTAGGTACTGG + Intergenic
941175506 2:162193074-162193096 CCAGGCACTGTGCTAGGTCCTGG - Intronic
941469093 2:165862311-165862333 CCAGGCACTGTGCCAGGCAGAGG - Intronic
941547421 2:166869508-166869530 CCAGGCACTGTGCTAGGAATGGG - Intergenic
941591554 2:167426615-167426637 CCAGGCAATGTGCTGGGTAGTGG - Intergenic
942497788 2:176558013-176558035 CCAGGTACTATGCTAGGTATTGG + Intergenic
942505877 2:176641105-176641127 CCAGGCACTGTGCTAGGTGATGG - Intergenic
942977412 2:182035023-182035045 CCAGGCACTGGGCTAGGTATTGG - Intronic
944023807 2:195139855-195139877 CAAGTCACCCAGCTAGGAAGTGG - Intergenic
945007255 2:205421959-205421981 CCAGGCACTGTGCTAGATATTGG + Intronic
945201062 2:207281997-207282019 CCAGGCACCATGATAGGCACTGG + Intergenic
945405538 2:209443342-209443364 CCAGGCACTCTGCTAGAAACTGG - Intronic
945407845 2:209471406-209471428 TAAGGCACCATGCTAGGTACTGG - Intronic
945619172 2:212111757-212111779 CCAGGCAGGGTGCTAGGTACTGG + Intronic
945632648 2:212301542-212301564 CCAGTCATCCTGCTAGGTGTTGG + Intronic
945855368 2:215062960-215062982 CCAGGCACCATTCTAGGCACTGG - Intronic
946007853 2:216540860-216540882 CCAGGCACTGTGCTAGGCACTGG - Intronic
946014944 2:216596288-216596310 CCAGGCACCCTGCTGAGCACTGG - Intergenic
946305591 2:218855364-218855386 CCAGGCTCCCAGCTGGGTAGCGG - Intergenic
946453183 2:219798846-219798868 CCAGGCACCATGCTGGGCATAGG + Intergenic
947302208 2:228700651-228700673 CCAGGCACTCTGCCAGGTACAGG - Intergenic
947502362 2:230680662-230680684 CCAGGCACTGTGCTAGGTAAGGG + Intergenic
948262774 2:236616361-236616383 CCAGGCACTGTGCTAGGTACAGG + Intergenic
948918924 2:241052428-241052450 CCATGTACCCTGCTTGGCAGTGG - Exonic
1168786713 20:545540-545562 CCAGACACTGTGCTAGGTACTGG + Intergenic
1168910340 20:1442035-1442057 CCAGTCACACTGCTAGTAAGTGG - Intergenic
1169435427 20:5583254-5583276 CCAGTCACCCAGCTGGGCAGTGG + Intronic
1169586087 20:7086975-7086997 CCAGGCACCCTGCTAGGCATGGG - Intergenic
1170509002 20:17057876-17057898 CCAGGCACCATGCCAGGTGCAGG - Intergenic
1170830396 20:19834395-19834417 CCAGGTACCCTGCTAAGCACAGG + Intergenic
1171382376 20:24743368-24743390 CCAGGCACCATACCAGGTACTGG + Intergenic
1172336151 20:34117695-34117717 TCAGGCACTCTGCTAGGTGCTGG - Intergenic
1172434406 20:34918898-34918920 CCAGGCACTTTGCTAGGTGTTGG + Intronic
1172641238 20:36441598-36441620 CCAGGCACTGTGCCAGGTACTGG - Intronic
1172791028 20:37505685-37505707 ACAGGCAGCCAGCTAGGTAGGGG - Intronic
1173197197 20:40925465-40925487 CCAGCCAGCCAGCCAGGTAGAGG - Intergenic
1173579614 20:44137688-44137710 CCAGGCACCGTGCCAGGTACTGG + Intronic
1173585932 20:44183249-44183271 CCAGGCACAGTGCTAGGCACTGG - Intronic
1173665066 20:44757390-44757412 CCAAGAACCCTGCTAGGCACTGG + Intronic
1174039732 20:47690363-47690385 CCAGGCACCCTGCTAGGCACTGG + Intronic
1174058549 20:47816384-47816406 CCAGGTACTCTGCTAGGTGCTGG - Intergenic
1174062827 20:47844630-47844652 CCAGGCACTGTGCTAGGTGCAGG - Intergenic
1174151180 20:48487626-48487648 CCAGGCACTGTGCTAGGTGCAGG - Intergenic
1174159731 20:48542260-48542282 CCAGGCACTCTGCTAAGTTCTGG + Intergenic
1174179120 20:48663966-48663988 CCAGGCACCGTGCCAGGTTCTGG - Intronic
1174202926 20:48819796-48819818 CCAGGCACTGTGCTAGGTGCTGG - Intronic
1174221000 20:48955482-48955504 CCAGGCACCATTCTAGGTGTTGG - Intronic
1174364463 20:50048138-50048160 CCAAGCACCATGCTAGGCACTGG - Intergenic
1175038161 20:56020085-56020107 CTAGGCACCATGCTGGGTATAGG - Intergenic
1175538507 20:59732821-59732843 CCAGGCACTGTGCTAGGTGCCGG + Intronic
1175787440 20:61720825-61720847 TCAAACACCCTGCCAGGTAGAGG + Intronic
1176111752 20:63414059-63414081 CCAGGCTCCCGGCTGGGCAGGGG + Intronic
1176969531 21:15249619-15249641 CCAGGCACGCTGAAAGGGAGTGG - Intergenic
1177271604 21:18855741-18855763 TCAGGCACTGTGCTAGGTACTGG + Intergenic
1178387235 21:32162676-32162698 CCAGGCACTCTACTAGGTTATGG - Intergenic
1178432636 21:32529927-32529949 CCAGACACCATGCTGGGTGGAGG + Intergenic
1179190879 21:39120989-39121011 CAAGGCAGCCTGCTTGGCAGGGG + Intergenic
1179546805 21:42118096-42118118 CCAGGCCCCTTGCTAGGAAGTGG - Intronic
1180046782 21:45310029-45310051 CCAGGCACCATCCTGGGTAATGG + Intergenic
1182041692 22:27243185-27243207 CCAGCCACTCTGCAAGGGAGTGG - Intergenic
1182268706 22:29139179-29139201 CCAGGCACTGTTCTAGGTACTGG + Intronic
1182608980 22:31530537-31530559 CCAGACACTGTGCTAGGTACTGG + Intronic
1182740999 22:32567412-32567434 CCAGGTACTCTGCTAGGTGGTGG + Intronic
1182785250 22:32902123-32902145 CCAGGCAGCCCCCTAGGTGGCGG + Intronic
1183201025 22:36386269-36386291 CCAGGGACTCTGCCAGGTGGTGG - Intronic
1183238940 22:36641298-36641320 CCAGGCACTGTGCTAGGTACTGG - Intronic
1183416578 22:37686126-37686148 CCAGGCACAGTCCTAGGCAGTGG + Intronic
1183467918 22:37989289-37989311 GCAGTCACTATGCTAGGTAGGGG - Intronic
1183474157 22:38026735-38026757 CCAGGCAGGCTGCTGGGGAGGGG + Intronic
1183665921 22:39245572-39245594 CCAGGCAACCAGCTAGGAGGAGG - Intergenic
1183994097 22:41620494-41620516 CCAAGCCCCCTGCAAGGTGGAGG + Intronic
1185081191 22:48710284-48710306 CCAGGCAGCCTGACAGGTTGGGG - Intronic
949243184 3:1895013-1895035 CATGGCCCCCTACTAGGTAGAGG + Intergenic
949477355 3:4461039-4461061 CCATGCACCATGCTAGGCAGTGG - Intronic
949694409 3:6677956-6677978 CCAGACACTCTTCTAGGTGGTGG + Intergenic
950276493 3:11665727-11665749 CCAGGCACTGTGCTAGGCACTGG + Intronic
950586581 3:13896349-13896371 CCAGGCACTGTTCTAGGCAGTGG + Intergenic
950646091 3:14377709-14377731 CCAGGCACCATGCTAGGCCTTGG - Intergenic
951890691 3:27565338-27565360 CCAGGCACACTGCCAGGGAGTGG - Intergenic
952333404 3:32385024-32385046 CCAGGCACTCTGCTAAATACTGG + Intergenic
952401491 3:32967831-32967853 CCCAGCACCCTGCCTGGTAGCGG + Intergenic
952858384 3:37792258-37792280 CCAGGCACTGTGCTAGGCACTGG + Intronic
953031417 3:39182339-39182361 GGAGGAACCATGCTAGGTAGAGG - Intergenic
953156519 3:40380115-40380137 CCAGGCACTGTGCTAGATACTGG - Intergenic
953646181 3:44757547-44757569 CCAGGCACTGTGCTAGGTGCTGG + Intronic
953817385 3:46170560-46170582 GCAGGCACAATGCTAAGTAGGGG - Intronic
954682514 3:52353372-52353394 CCCGGCAGCCTGCCAGGAAGTGG + Exonic
954994590 3:54870042-54870064 CTAGGCACCATCCTAGGTAGTGG + Intronic
955481299 3:59393255-59393277 CCAGGCACTGTACTAGGTACAGG + Intergenic
955598217 3:60614738-60614760 CCAGGCACCCTGTTACGATGGGG - Intronic
955856579 3:63278919-63278941 CGAGGCACCCTGCTTGGAGGCGG + Intronic
955871965 3:63448709-63448731 CCAGGCACCATGCTAGGCATGGG + Intronic
956055004 3:65289434-65289456 CCAGGCCCTCTGGTAGGTACCGG + Intergenic
956349353 3:68317611-68317633 CCAGGGACCATGATAGGTACAGG - Intronic
956682153 3:71790851-71790873 CCAGGCATCTTTCTAGGTACTGG - Intergenic
957064703 3:75512008-75512030 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
958148034 3:89652912-89652934 CCAGGCACCCTTCCAGGTAACGG + Intergenic
958860761 3:99442924-99442946 CAAGGAACACTGCTAGGTACTGG - Intergenic
960624909 3:119673282-119673304 CCAGGCACTGTTATAGGTAGTGG + Intronic
960671543 3:120159359-120159381 CCAGGCACAGTGCTAGGTGTGGG + Intergenic
960671818 3:120161723-120161745 CCAGGCACAGTGCTAGGTACTGG + Intergenic
961288650 3:125827385-125827407 CCAGGCACTGTGCTGGGTGGTGG + Intergenic
961513027 3:127414740-127414762 CCAGGCACCATCCTAGGCATGGG + Intergenic
961654011 3:128431757-128431779 CCAGGGACCATGCTAGGTTTGGG + Intergenic
961898413 3:130188645-130188667 CCAGGCACTGTGCTGGGTGGTGG - Intergenic
961926600 3:130487956-130487978 CCAGGCACCATCCTGGGTACTGG - Intergenic
962382377 3:134908431-134908453 CCAGGCAGCCTGCAGGGAAGGGG + Intronic
963869000 3:150393611-150393633 CCAGGTACTGTGCTAGGTACTGG + Intergenic
964155658 3:153581989-153582011 CCAGGCACTGTTCTTGGTAGTGG - Intergenic
964205244 3:154167237-154167259 CCAGGCACTGTGCTAGGCATTGG + Intronic
964376788 3:156055774-156055796 CCAGGCACCATTCTAGGTACTGG - Intronic
964423982 3:156532910-156532932 CCTGGCATCGTGCTAGGCAGTGG + Intronic
964478087 3:157115086-157115108 CCGACCACCCTGTTAGGTAGGGG - Intergenic
964646410 3:158962893-158962915 CCAGGCACCATGCTAGGTGCTGG + Intronic
964851363 3:161099696-161099718 CCAGGCACTATGCTAGGTGCTGG - Intronic
965078216 3:164004302-164004324 CCAGGCGTCCTGCTTGGCAGCGG - Intergenic
965597681 3:170424174-170424196 CCAGACACCATGGTAGGTACTGG + Intronic
965754374 3:172010452-172010474 CCTGGCACTCTTCTAGGTACTGG - Intergenic
965754611 3:172012936-172012958 CCAGACACTCTGCTAGGTGCTGG - Intergenic
965847565 3:172982046-172982068 CCAGGCACCATTCTAGGCACAGG - Intronic
966770374 3:183498722-183498744 TCAGGCACAGTGCTAGGTACAGG + Intronic
967144152 3:186591981-186592003 CCAGGCACTGTGCTAGGTGCTGG + Intronic
967485149 3:190021762-190021784 CCAGGCATAATGCTAGGTACTGG + Intronic
967527614 3:190513422-190513444 CCAGGCACTGTGCTAGGCAATGG + Intergenic
967939712 3:194756526-194756548 CATGGCACCCTGCCAAGTAGAGG - Intergenic
968127269 3:196169194-196169216 CCAGGCACCCTGCTGCTCAGAGG + Intergenic
968844124 4:3030476-3030498 CCAGGCACCGTCCTAGGCATTGG + Intronic
968931318 4:3581060-3581082 CCAGGCATCCTGCTAGATGCTGG + Intronic
969079515 4:4607711-4607733 CCAATCACCGTGCTAGGCAGTGG + Intergenic
969090279 4:4688894-4688916 CCAGGCACCGTGCTAGGCAACGG - Intergenic
969289314 4:6228500-6228522 CCTGGCACCATGCTAGGTGCTGG + Intergenic
969906760 4:10404276-10404298 CTCGGCACCCAGCTAGGAAGTGG - Intergenic
970133282 4:12894379-12894401 CCAGGCACCATGCTAGGCACAGG - Intergenic
970499255 4:16660589-16660611 CCAGGCACCTTGCTAGGTTCTGG + Intronic
972277112 4:37567732-37567754 CCAGGCACTGTGCTAGGTTCTGG - Intronic
972317046 4:37936484-37936506 CCAGGCACTCTGCTAGGAGGTGG - Intronic
972549747 4:40119715-40119737 CCAAGCATCATGCTAGGTAATGG + Intronic
972598865 4:40554086-40554108 CCAGGCACCGTGCTGGGTCCTGG - Intronic
973223134 4:47751796-47751818 CCAGGCACACTGCTAGATGCTGG - Intronic
973637371 4:52872536-52872558 CCAGGCACTGTGCTAGGTTCTGG - Intergenic
973778334 4:54264466-54264488 CCAGGCACTGTGCTAGGTTCTGG + Intronic
974026012 4:56733735-56733757 CCAGGCACTCTGCTAAGTGCTGG + Intergenic
974043610 4:56878815-56878837 CCAGGCACTGTGCTAGGTGCTGG + Intergenic
975294098 4:72712152-72712174 CCAGGCACCGTCCTTGGCAGTGG - Intergenic
977127983 4:93194626-93194648 CCAGACACATTGCTAGGTACTGG - Intronic
978292263 4:107155522-107155544 CCAGGCATTGTGCTAGCTAGTGG - Intronic
979050168 4:115920763-115920785 CCAGGCACCCAGCTAGGCGCCGG + Intergenic
979443013 4:120774668-120774690 CCAGCCACACTGCTAGACAGTGG + Intronic
979464261 4:121018122-121018144 CCAGGCACCATGCTAGGTAATGG - Intergenic
982114752 4:152088869-152088891 CCAGGCACTGTGCTAGGTGCTGG + Intergenic
982617681 4:157661613-157661635 CCAGGCACCATGCTAAGCACTGG + Intergenic
982997940 4:162374978-162375000 CCAGGCACCATGCTAAGTAAAGG - Intergenic
983861320 4:172710939-172710961 CCAGGCACTCTTATAGGTACTGG + Intronic
984474497 4:180218602-180218624 GCAGGCACCCTGTTAGTTAGAGG - Intergenic
985062902 4:186095873-186095895 CCAGTCACCCTTCTAGATAGTGG - Intergenic
985165005 4:187083593-187083615 CCAGGCACTGTTCTAGGTACTGG + Intergenic
985792246 5:1935655-1935677 CTAGTCACCCTGCTAGGGAATGG - Intergenic
987751701 5:22047583-22047605 CCAAGCACTCTGCTAGGTAAAGG + Intronic
988878252 5:35472057-35472079 CCAGGCTGCCTGCTAGGCACTGG + Intergenic
989204192 5:38795396-38795418 CCAGGCACTGTGCTAGGCATGGG + Intergenic
990678104 5:58211468-58211490 CCAGGCACAGTTCTAGGTACTGG - Intergenic
990929589 5:61074095-61074117 CCAGGCACTATGCTAGGAACTGG - Intronic
991116114 5:62957575-62957597 CCAGGCACTATTCTAGGTATTGG + Intergenic
991240834 5:64458351-64458373 CTAGGCACTCTTCTAGGCAGTGG - Intergenic
991990737 5:72336445-72336467 CCAGGCACTGTGTTAGGTGGTGG - Intronic
992533069 5:77671019-77671041 CCAGGCACCATGCTAGGCTCTGG - Intergenic
992738827 5:79752158-79752180 CCAGGCATTGTGCTAGGTACTGG - Intronic
992776397 5:80092926-80092948 CCAGGCACTGTGCTAGATACTGG + Intergenic
993040694 5:82811180-82811202 CCAGGCACTCTGCTTGGTGTTGG - Intergenic
993085838 5:83362951-83362973 CCAGGCACGCTGCTAGGCACTGG + Intergenic
993418769 5:87672983-87673005 CCAGGCACCCTTCTAGGTGTGGG + Intergenic
993489016 5:88523516-88523538 CAAGGCACCTTGCTAAGTAGTGG + Intergenic
994169975 5:96648765-96648787 ACAGTCACACAGCTAGGTAGTGG + Intronic
994676866 5:102834376-102834398 TCAGGCACTGTGCTAGGTACTGG + Intronic
995540589 5:113182420-113182442 CCAGGCATTCTGTTAGGTATGGG + Intronic
997235343 5:132269246-132269268 CCCTGCACCCTGCTGGGTAGGGG + Intronic
997426102 5:133803723-133803745 CCAGGCACTATGCTAGGCACTGG + Intergenic
997505362 5:134412341-134412363 CCAGGCACATTGCTAGGTGCTGG + Intergenic
997803548 5:136890663-136890685 CCAGGCACCATGCTAGGGGTGGG + Intergenic
997826422 5:137110799-137110821 CCAGGCACTGTGCTAGGTGCTGG - Intronic
998818986 5:146041452-146041474 CTAGGCACCGTGCTAGGCACTGG - Intronic
999078343 5:148818796-148818818 CCTTGCACCCTGCTTGGTAATGG + Intergenic
999711192 5:154320006-154320028 CCAGGTACCCTGCTGGATACTGG + Intronic
999805946 5:155081452-155081474 CCAGGCACCGGGCTAGGTGCTGG + Intergenic
999893425 5:156003296-156003318 CCAGGCACACTGCTACGTGCTGG - Intronic
999928101 5:156401638-156401660 CCAGGCACTGTGCAAGGTACTGG + Intronic
1000018584 5:157299996-157300018 CCAGGCACCATTCTAGGTCCCGG - Intronic
1000257297 5:159552152-159552174 CCAGGCACCATGCTAGTTCCTGG + Intergenic
1001164945 5:169356027-169356049 CCAGGCTCTCTGCTAGGTTCTGG + Intergenic
1001403106 5:171458093-171458115 CCAGGCACTCTTCTAGGTACTGG + Intergenic
1001560872 5:172668231-172668253 CCAGGCACCATGCCAGGCACTGG - Intronic
1001579804 5:172790847-172790869 CCAGGCATCCTGCTAGGTGTTGG - Intergenic
1002099657 5:176851058-176851080 CCTGGCACCGTGCTAGGCACCGG - Intronic
1002375175 5:178783674-178783696 CCAGGCACGGGGCTAGGGAGGGG - Intergenic
1003447528 6:6198600-6198622 CCAGGCACCTTGGTAGGTGCTGG + Intronic
1003597180 6:7484313-7484335 CCAGGCACTTTGAGAGGTAGGGG - Intergenic
1004523451 6:16383652-16383674 CCAGGCACCCAGCTAGTCTGGGG + Intronic
1005486164 6:26301910-26301932 CCAGCCACTGTGCTAGGTACTGG + Intergenic
1005661845 6:28006101-28006123 CCAGGCTCCCTCCTAGCTATAGG + Intergenic
1006442980 6:34063486-34063508 CCAGGCACCCTGCTGGCCTGGGG + Intronic
1006626823 6:35403589-35403611 CCAGGCACCGTGCCAGGTGCTGG + Intronic
1006925445 6:37651832-37651854 CCAGGCACTGTGCTAGGTCCTGG - Intronic
1007026658 6:38582932-38582954 CCAGGCACCATGCAAGGTATCGG + Intronic
1007153903 6:39723943-39723965 CAAGGCACCCAGCTGGGGAGTGG - Intronic
1007520866 6:42451389-42451411 CCAGGTTCCCTGCTGGGGAGAGG - Intronic
1008552941 6:52650500-52650522 CCAGGCACTGTGCTAGGCACAGG + Intergenic
1010443693 6:75927773-75927795 CCAGGCACCCTGCTAGATGCTGG - Intronic
1011412119 6:87076636-87076658 CCAGGCACTGTGGTAGGTATTGG - Intergenic
1011514447 6:88137264-88137286 CTAGGCATTCTGGTAGGTAGAGG + Intergenic
1011516225 6:88156698-88156720 CCAGGCACTGTGCCAGGCAGAGG - Intronic
1012414819 6:99001849-99001871 CCAGGCATTGTGCTAGGTACAGG + Intergenic
1012917626 6:105187555-105187577 CCCGGCACCCTGGGAGGTTGAGG + Intergenic
1013003015 6:106043372-106043394 CCAGGCACTGTGCTAAGCAGTGG - Intergenic
1013639383 6:112058439-112058461 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1014221146 6:118799992-118800014 CCAGGCACTGTGCTAGGCACTGG - Intergenic
1014281440 6:119446336-119446358 CCAGGCACTGTTCTAGGTGGAGG - Intergenic
1015008575 6:128314347-128314369 CCAGGCACCCTTCTGGGTGCTGG - Intronic
1016915211 6:149238156-149238178 CCAGGCACCGTGCTGGGTGTTGG - Intronic
1018039002 6:159905195-159905217 CCAGGCACTGTGCTAGGCACTGG - Intergenic
1021931682 7:25587087-25587109 CCAGGAACTCTGCTAGGCACAGG - Intergenic
1022417299 7:30189278-30189300 CCAGGCACTGTGCTAGGCATAGG + Intergenic
1022570518 7:31448743-31448765 CCAGGAACCCTGCTTGGTGGAGG + Intergenic
1022606354 7:31818428-31818450 CCAGGCACCATGCTAAGCACTGG - Intronic
1022624325 7:32019054-32019076 CCAGGCATAGTGCTAGGTAAGGG + Intronic
1023380267 7:39600126-39600148 CTAAGCACTATGCTAGGTAGTGG - Intronic
1023723192 7:43115956-43115978 CCAGGCAAACTGCTAGGTGCTGG - Intronic
1023826592 7:44014219-44014241 CCAGGCGCCCTGCCAGGAACAGG + Intergenic
1024525508 7:50345587-50345609 CCAGGCACTCTGCTAGGCAGAGG + Intronic
1024565110 7:50674173-50674195 CAAGGCACTGTGCTAGGTAGAGG - Intronic
1025035290 7:55589808-55589830 CCAGGCTCCCTGCAGGGTAAGGG - Intergenic
1025231570 7:57206281-57206303 CCAGGCACTGTGCTAGGTGCAGG + Intergenic
1026379510 7:69784885-69784907 CCAGGCACCCTTCTAGGTACTGG + Intronic
1027904223 7:84158671-84158693 CCAGGCACTGTGTTAGGTACAGG - Intronic
1028439655 7:90845145-90845167 CAAGGCACTGTGCTAGGTACTGG - Intronic
1028740349 7:94267554-94267576 CCAGGCTCCATGCTAGGTGCCGG - Intergenic
1029308873 7:99642819-99642841 CCAAGCACCATTCTAGGTAGTGG - Intergenic
1029647270 7:101865789-101865811 GCAGGCACAATGGTAGGTAGTGG + Intronic
1029754881 7:102567623-102567645 CCAGGCGCCCTGCTAGGAACAGG + Intronic
1029772831 7:102666703-102666725 CCAGGCGCCCTGCTAGGAACAGG + Intronic
1029982120 7:104888596-104888618 CCAGGCATTCTGCTAGGTCATGG + Intronic
1030082417 7:105789291-105789313 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1030717803 7:112831055-112831077 CTAGGCACTCTTCTAGGTACTGG + Intronic
1031931936 7:127694392-127694414 CCAGGAACCCACCTAGGCAGAGG - Intronic
1032127060 7:129202868-129202890 CCAGATGCCCTGCTAGGGAGTGG - Intronic
1033191797 7:139288148-139288170 CCAGGCACTCTTCTAGGTGCTGG + Intronic
1033431862 7:141296461-141296483 CTAGGCACCATGCTAGGCTGAGG + Intronic
1034885726 7:154797202-154797224 CCAGGCACCATGCTAGGCTGTGG + Intronic
1035037211 7:155903121-155903143 CCAGGCACGGTTCCAGGTAGGGG + Intergenic
1035148020 7:156840166-156840188 CCAGGCACTCTTCTAGGAACTGG + Intronic
1037076964 8:14732288-14732310 CCATCCACCCTGCTAAGGAGGGG + Intronic
1037575605 8:20199293-20199315 TCAGGCACTGTGCTAGGCAGTGG - Intronic
1037575722 8:20200366-20200388 TCAGGCACTGTGCTAGGCAGTGG - Intronic
1037761010 8:21741576-21741598 CCAGGCACCATGCTAGACACTGG - Intronic
1037776998 8:21842124-21842146 CCAAGCACTCTGCTAGGTGCTGG - Intergenic
1038529674 8:28308167-28308189 CCAGGCACCATGCTAGGGGCTGG - Intergenic
1038777593 8:30544910-30544932 CCTGGCTCCCAGCTAGCTAGAGG + Intronic
1039425047 8:37478626-37478648 CCAGGCACTGTGCTAGGTACTGG + Intergenic
1039949947 8:42162544-42162566 CCAGGCACTGTGCTGGGTACTGG + Intronic
1040017918 8:42715078-42715100 CCAGGCGCCCTGCTAGATCCTGG + Intronic
1040582760 8:48710751-48710773 ACAGAAACCCTGCGAGGTAGAGG + Intergenic
1041173934 8:55173613-55173635 CCTGGCACTGTGCTAGGCAGTGG - Intronic
1042165691 8:65943664-65943686 CAAGGCACCATGCTAGGTAATGG - Intergenic
1042865567 8:73353938-73353960 CCAGGCACCATGATAGGCATTGG + Intergenic
1042953185 8:74221800-74221822 CCAGGCCCCCTGCTGGGTCTCGG - Intergenic
1043011110 8:74883083-74883105 CCAGGCACTATTCTAGGAAGTGG - Intergenic
1043018385 8:74969678-74969700 CAAGGCACTGTGCTAGGTAATGG + Intergenic
1044365820 8:91343984-91344006 CCAGGCATTCTGCTGGGTACTGG + Intronic
1044428387 8:92080708-92080730 CCAGGCACTGTGCTAGGCACTGG - Intronic
1044694272 8:94906941-94906963 CCAGGCACAATGCTAGGTGCTGG - Intronic
1044694375 8:94908170-94908192 CCAGGCACAATGCGAGGTACTGG - Intronic
1045010635 8:97955839-97955861 CCAGGCACTGTGCTAGATACCGG + Intronic
1045406005 8:101867382-101867404 CCAGGCACTGTGCTAGGTCCTGG - Intronic
1045439882 8:102198611-102198633 CCAGGCACTGTGTTAGGTAATGG - Intergenic
1045699840 8:104853072-104853094 CCAGGCACTCTGTTAGGCACAGG + Intronic
1045747165 8:105436706-105436728 CCAAGCACACTGCTAGTAAGTGG - Intronic
1046331314 8:112718839-112718861 CCAGGCACTGTGTTAGGTAATGG - Intronic
1046738429 8:117802853-117802875 CCAGGCACTGTTCTAGGTATTGG - Intronic
1046766963 8:118080017-118080039 CCAGGCACCCTGCTAGGCACTGG + Intronic
1046986591 8:120395222-120395244 CCAGGCACAGTGCTAGGTCCTGG - Intronic
1047010060 8:120662912-120662934 CTAGGCAGCCTGCTAGGTACTGG + Intronic
1047066730 8:121292189-121292211 CCAGGTACTTTGCTAGCTAGTGG + Intergenic
1047386042 8:124410177-124410199 CCAGGCACTAGGCTAGGTACTGG - Intergenic
1047739121 8:127793282-127793304 TCAGGCACCCAGCTAGGCAATGG - Intergenic
1047928897 8:129706940-129706962 CCAGGCACTGTGCTAGGTTCTGG + Intergenic
1048013813 8:130480286-130480308 CCAGGCACTATGCTAGGCACAGG + Intergenic
1048211930 8:132461594-132461616 ACAGGCACCCTGGAAGGCAGTGG - Intronic
1048688568 8:136932848-136932870 CCAGGCACTGTGCTAGGCATTGG - Intergenic
1049302674 8:141879888-141879910 CCAGGCACCGTGCTAGGCTCAGG - Intergenic
1049587258 8:143437816-143437838 CCTGGCACCCTGGAAGGTGGTGG + Exonic
1049642566 8:143722127-143722149 CTGGGCACCCTGCAAGGCAGAGG - Exonic
1049719207 8:144107886-144107908 CCGGGCATCCCGCTAGGAAGTGG + Intronic
1050463859 9:5899794-5899816 CCAGGCACTGTGCTAGGCACTGG - Intronic
1051123010 9:13772990-13773012 CCAGACACCGTGCTAGGTGTGGG - Intergenic
1051564691 9:18484131-18484153 TCAGGCACTGTGCTAGGTACTGG + Intronic
1051918917 9:22240718-22240740 CCAGGCACCTTGCTAGACATTGG - Intergenic
1052028195 9:23598381-23598403 CCAGGCACCATTCTAGGTACTGG + Intergenic
1052200509 9:25773005-25773027 CCAAGCACTCTGCTTGGAAGTGG - Intergenic
1052839225 9:33277253-33277275 CCAGGTACTCTACTAGGTGGTGG + Intronic
1052983007 9:34462509-34462531 CCAGGTATTGTGCTAGGTAGAGG - Intronic
1053114823 9:35490912-35490934 CCAGGCACCGTGCTGGGGACCGG - Intronic
1053158379 9:35795915-35795937 CCAGTCACTGTGCTAGGTACTGG + Intronic
1053206792 9:36192946-36192968 TCAGACACACTGCTAGGCAGTGG - Intronic
1054458807 9:65450871-65450893 CCAGGCATCCTGCTAGATGCTGG - Intergenic
1055069346 9:72150044-72150066 CCAGGCACAGTGCTAGGTGTTGG - Intronic
1055161775 9:73138357-73138379 CCAGGCACTGTGCTAGGAAATGG + Intergenic
1057220671 9:93256232-93256254 CCAGGCCCCCTCCTGGGCAGGGG - Intronic
1057516056 9:95722357-95722379 CCAGGCATCCTGCCAGGTCTGGG + Intergenic
1057865081 9:98674145-98674167 CCAGGCACCATCCTGGGCAGTGG - Intronic
1057868944 9:98703400-98703422 CCAGGCAGCATGCTGGGCAGTGG + Intronic
1058536736 9:105968537-105968559 CCAGGCACTGTGCTAGATACTGG - Intergenic
1058778616 9:108310558-108310580 CCAGGCACTCTGGTAGGTGCTGG - Intergenic
1059610050 9:115882942-115882964 CCAGTCTCCCAGCTAGGAAGTGG - Intergenic
1059710794 9:116865922-116865944 CCAGGCACAATGCTAGGTGCTGG + Intronic
1060080587 9:120640521-120640543 CCAGGCACTGTGCTAGGCACTGG - Intronic
1060418997 9:123454177-123454199 CCAGGCACCCTGCTGGGTACTGG - Intronic
1060484588 9:124039136-124039158 CCAGGCCCTCTGCTGGGCAGTGG + Intergenic
1061043788 9:128153726-128153748 CTGGGCACCCTCCTAGGCAGGGG - Intergenic
1061504586 9:131024744-131024766 TCAGGCACCTTGCTAGGCACTGG + Intronic
1061805201 9:133133822-133133844 ACAGGCACCTTTCTAGGTAGGGG + Intronic
1061897942 9:133658302-133658324 CCATTCACCCTGCAAGGAAGGGG - Exonic
1061932035 9:133838303-133838325 CCAGGCACTGTGCTAGGCAGAGG - Intronic
1062566574 9:137166344-137166366 CCAGGCACCATGGTGGGGAGGGG + Intronic
1062729871 9:138102885-138102907 CCGGGCACCCTGAAAGGGAGAGG - Intronic
1186512591 X:10141224-10141246 CCAGGCACTGTTCTAGGTACTGG + Intronic
1186794177 X:13028638-13028660 CCAGGCACGGTGCTAGGCACTGG + Intergenic
1187397812 X:18933418-18933440 CCAGGCACCAGGCTAGCTACTGG - Intronic
1187422792 X:19150795-19150817 CCAGGTACCATGCTAGGTTCTGG + Intergenic
1187537590 X:20157254-20157276 CCAGGCATTCTGCTAGGCACTGG + Intronic
1188267169 X:28091558-28091580 TCAGGCACCGTGCTAGGCACTGG - Intergenic
1188468400 X:30508975-30508997 CCAGGCACTGTGCTAGGTCCTGG + Intergenic
1188515754 X:30983769-30983791 CCAGCCACCTTACTAGATAGCGG - Intergenic
1189412438 X:40784679-40784701 CCAGGCATGATGCTAGGTAGTGG + Intergenic
1189722438 X:43933919-43933941 CCAGGCACTCTTCTAGGTGCTGG - Intergenic
1189994362 X:46624914-46624936 CCAGGCACCATGCTGGGTGCTGG + Intronic
1190119315 X:47647532-47647554 CCAGGCACTCTTCTAGGTGCTGG - Intronic
1190483695 X:50902986-50903008 CCAGGCACTATGCTAGGCACTGG - Intergenic
1190711595 X:53075504-53075526 CCAGGCACTGTTCTAGGTATTGG - Intronic
1192033303 X:67538018-67538040 CCAGGCACTCTGCTAGACACTGG - Intergenic
1192183138 X:68928870-68928892 CCAGGCACTGTGCGAGGAAGTGG - Intergenic
1192773782 X:74221095-74221117 CCAGGCACTGTGCTGGGTAGTGG - Intergenic
1193761688 X:85474819-85474841 TCAGGCACTGTGCTAGGTACTGG - Intergenic
1194592312 X:95814533-95814555 CCAGGCACTATGCTAGGCACTGG + Intergenic
1195156593 X:102129356-102129378 TCAGGCACTGTGCTAGGTATTGG - Intergenic
1195230897 X:102845777-102845799 CCTGGCACCATGCTAGGCACTGG - Intergenic
1195504441 X:105641322-105641344 CCAGGCACTCTGCTAGGTAAGGG + Intronic
1196802919 X:119559652-119559674 CCAGGCACTGAGCTAGGTACTGG - Intronic
1197703220 X:129615629-129615651 CCAGGCACAGTGCTAGGTGCTGG + Intergenic
1197717055 X:129717151-129717173 CCAGGCACTGTGCTAGGTGCTGG - Intergenic
1198029779 X:132743663-132743685 CTAGGCACCCAGCTAGGAAGTGG + Intronic
1198079941 X:133230082-133230104 ACAGACACCCTGTTAGGTATGGG + Intergenic
1198666869 X:139034146-139034168 CCAGGCACTGTGCTAGGTGCTGG + Intronic
1198735965 X:139785650-139785672 CCAGGCACAGTGCTAGGTGCTGG + Intronic
1199510948 X:148621772-148621794 CCAGGTACTCTGCTAGGTGCTGG + Intronic
1200010094 X:153114313-153114335 CCAGGCACACAGAGAGGTAGGGG - Intergenic
1200029506 X:153285609-153285631 CCAGGCACACAGAGAGGTAGGGG + Intergenic
1200488901 Y:3799551-3799573 CCAGGCACTCTGATAATTAGTGG - Intergenic