ID: 1068931449

View in Genome Browser
Species Human (GRCh38)
Location 10:62594482-62594504
Sequence CGAGAGCCAGGCACCCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 389}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931449_1068931452 -10 Left 1068931449 10:62594482-62594504 CCTAGCAGGGTGCCTGGCTCTCG 0: 1
1: 0
2: 1
3: 52
4: 389
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931449_1068931454 -2 Left 1068931449 10:62594482-62594504 CCTAGCAGGGTGCCTGGCTCTCG 0: 1
1: 0
2: 1
3: 52
4: 389
Right 1068931454 10:62594503-62594525 CGGCTGATGCTCTGGGTCTGTGG No data
1068931449_1068931453 -9 Left 1068931449 10:62594482-62594504 CCTAGCAGGGTGCCTGGCTCTCG 0: 1
1: 0
2: 1
3: 52
4: 389
Right 1068931453 10:62594496-62594518 TGGCTCTCGGCTGATGCTCTGGG No data
1068931449_1068931456 30 Left 1068931449 10:62594482-62594504 CCTAGCAGGGTGCCTGGCTCTCG 0: 1
1: 0
2: 1
3: 52
4: 389
Right 1068931456 10:62594535-62594557 ATGAATGCTGCTGCCCCTCTAGG No data
1068931449_1068931455 6 Left 1068931449 10:62594482-62594504 CCTAGCAGGGTGCCTGGCTCTCG 0: 1
1: 0
2: 1
3: 52
4: 389
Right 1068931455 10:62594511-62594533 GCTCTGGGTCTGTGGACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931449 Original CRISPR CGAGAGCCAGGCACCCTGCT AGG (reversed) Intronic
900511812 1:3064386-3064408 GGAGAGCTGGGCACCCTGGTGGG + Intergenic
900521673 1:3108586-3108608 CTAGGGACAGGCACCCTGCCAGG + Intronic
900617109 1:3570443-3570465 GGATAGCCAGGCAGGCTGCTGGG + Intronic
900686813 1:3953989-3954011 AATGAGCCAGCCACCCTGCTGGG - Intergenic
900750099 1:4390260-4390282 CCAGAGCCTGGCTCCCTGGTTGG + Intergenic
901012416 1:6209268-6209290 GGAGAGCCGGGCACACTGCGTGG + Exonic
901208047 1:7508579-7508601 CCTGAGCCAGGCACAGTGCTGGG - Intronic
901430845 1:9213846-9213868 CATGGGCCAGGCACCATGCTAGG + Intergenic
901464547 1:9413021-9413043 TGTGTGCCAGGCACCGTGCTGGG + Intergenic
901713009 1:11130478-11130500 AGAGAGCCTGGCACCTTGGTTGG + Intronic
901876605 1:12170227-12170249 CCAGAGCCAGGCACTGGGCTGGG - Intronic
903820888 1:26101698-26101720 AAAGTGCCAGGCACCGTGCTAGG - Intergenic
904114836 1:28154148-28154170 TTGGAGCCAGGTACCCTGCTAGG + Intronic
904127245 1:28249735-28249757 CCAGAGCCAGGCACAGTGCCTGG + Intergenic
904469210 1:30725638-30725660 CCTGTGCCAGGCACCATGCTGGG - Intergenic
904799283 1:33081461-33081483 CCAGAGCCAGGCGCGCTGCTAGG - Exonic
904899602 1:33846592-33846614 TAAGAGCCAGGCACAGTGCTAGG - Intronic
905463399 1:38135671-38135693 CATGAGCCAGGCACCGTGTTTGG + Intergenic
906157362 1:43621620-43621642 CCAGAGCCAGGCACACCACTGGG - Intronic
906306533 1:44723629-44723651 GGAAAGCCTGGCACCCTGCCTGG + Intronic
906512828 1:46420851-46420873 TGAGTACCAGGCACCATGCTGGG - Intergenic
906936971 1:50222848-50222870 CTATTGCCAGGCACCATGCTGGG + Intergenic
907751885 1:57270804-57270826 TTAGTGCCAGGCACCTTGCTTGG + Intronic
909554624 1:76939751-76939773 CGTGTGCCAGGCACTGTGCTAGG + Intronic
909949781 1:81705527-81705549 CGTGAGCCATGCGCCCGGCTGGG + Intronic
910227852 1:84954761-84954783 TGAAAGCCAGGCACTGTGCTAGG + Intronic
912713473 1:111965900-111965922 TGTGTGCCAGGCACTCTGCTGGG + Intronic
912862620 1:113227573-113227595 TGAGTGCCAGGCACTCTTCTAGG - Intergenic
915205352 1:154266564-154266586 CCAGAGCCAGGCACCTACCTGGG - Exonic
915961022 1:160266875-160266897 CCAGATCCAGGCAGCCTTCTGGG - Intergenic
917977086 1:180246889-180246911 TGTGTGCCAGGCACCGTGCTAGG + Intronic
918077032 1:181178358-181178380 GGAGAGCCAGGCACATGGCTGGG + Intergenic
918140729 1:181717376-181717398 AGACAGCAAAGCACCCTGCTAGG + Intronic
918321265 1:183367121-183367143 TGTGATCCAGGCACCATGCTAGG - Intronic
919944899 1:202311945-202311967 CCAGAGCCAGCCAGGCTGCTGGG - Intronic
920849565 1:209619379-209619401 CAAGTGCCAGGCACTGTGCTGGG - Intronic
922203024 1:223422706-223422728 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
922984077 1:229852445-229852467 TGAGTGCCATGCACCCTGCATGG + Intergenic
923497880 1:234540744-234540766 TGAGTGCCAGGCACTGTGCTGGG - Intergenic
1063174273 10:3537764-3537786 CCAGTGCCTGGCACCATGCTGGG + Intergenic
1063264719 10:4435190-4435212 TGAGTGCCAGGCACCATTCTAGG + Intergenic
1063455994 10:6182985-6183007 CTGGAGCCAGGGACCGTGCTGGG - Intronic
1064367772 10:14723704-14723726 CCAGATCCAGGCAGCCTTCTGGG - Intronic
1064542322 10:16417478-16417500 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1064925844 10:20568185-20568207 CAAGTGCCAGCCACCATGCTTGG + Intergenic
1065122729 10:22544438-22544460 GCAGAGCCAGGCACCGTGCTAGG - Intronic
1065421545 10:25550277-25550299 CCTGAGCCAGGCACTGTGCTAGG - Intronic
1066188046 10:33029808-33029830 AGAGAGCCAGGCACCATGATGGG + Intergenic
1066758287 10:38731341-38731363 CGTGTGCCAGGCACCATGCCAGG - Intergenic
1067925787 10:50506815-50506837 CAGGTGCCAGGTACCCTGCTAGG + Intronic
1068931449 10:62594482-62594504 CGAGAGCCAGGCACCCTGCTAGG - Intronic
1071118448 10:82250809-82250831 CTAGAGCCAGGCACCAGGCAAGG - Intronic
1075633547 10:124015682-124015704 CATGTGCCAGGCACCCTGCTAGG + Intronic
1076054829 10:127364003-127364025 ATAGTGCCAGGCACCGTGCTAGG - Intronic
1076435735 10:130440065-130440087 CAGGAGCCAGGCACCCAGCAAGG - Intergenic
1077043856 11:535841-535863 GGAGAGCCCGGGGCCCTGCTCGG - Intronic
1077501423 11:2911324-2911346 TGGGAGCCAAGCACACTGCTGGG + Intronic
1077607481 11:3621874-3621896 CCAGTGCCAGGCACCATGCTTGG - Intergenic
1078738986 11:14048990-14049012 CAAGAGCCAGGCACTGTTCTGGG + Intronic
1080809240 11:35686424-35686446 TGAGAGTCAGGCACTTTGCTAGG + Intronic
1081630769 11:44688188-44688210 CCAGAGCCAGCCATCCTGCCAGG - Intergenic
1081676355 11:44972221-44972243 CCAAAGCCAAGAACCCTGCTGGG - Intergenic
1082086573 11:48055212-48055234 CATGTGCCAGGCACCATGCTAGG - Intronic
1082816713 11:57514382-57514404 AGAGAACCCGGCAGCCTGCTAGG - Intronic
1083595856 11:63917980-63918002 CCAGACCCAGCCACCCTGCCAGG + Intergenic
1083815523 11:65130434-65130456 CAATAGCCAGGCCCCCTGCCTGG - Intronic
1083839309 11:65294674-65294696 AGAAAGCCAGTCATCCTGCTTGG - Intronic
1084512360 11:69614181-69614203 GGAGAGCCAGGCTCCCAGCTAGG - Intergenic
1085325565 11:75603743-75603765 CGTGTGCCAGGCACTGTGCTAGG - Intronic
1090228408 11:125085158-125085180 CGAGGGCCAGGGACCGTTCTGGG + Intronic
1090295747 11:125586257-125586279 CTATAGCCAGGCACAGTGCTGGG - Intergenic
1090363952 11:126191015-126191037 CGCGAGCCAGGCACGGTGCTGGG - Intergenic
1090441449 11:126728490-126728512 CCAGGGCCAAGCACCCTGCCTGG + Intronic
1090550702 11:127816792-127816814 CTAGTGCCAGGCATCCTGCTGGG + Intergenic
1091132943 11:133161886-133161908 CGGGAGGCAGGCACTGTGCTGGG - Intronic
1091597694 12:1890005-1890027 CGGAAGCAAGTCACCCTGCTTGG + Intronic
1092526577 12:9313413-9313435 TGAGAGCCAGGCTTCCTGCTTGG + Intergenic
1092540699 12:9418369-9418391 TGAGAGCCAGGCCTCCCGCTTGG - Intergenic
1094629833 12:32162572-32162594 CATTAGCCAGGCACTCTGCTAGG - Intronic
1095765486 12:45889656-45889678 CGTGAGCCAGCCACCGTGCCTGG - Intronic
1096766462 12:53894534-53894556 TGTGAGCCAGGCACAGTGCTAGG - Intergenic
1097044561 12:56177895-56177917 CATGAGCCAGGCACTATGCTAGG - Intronic
1097580708 12:61453536-61453558 CTAGTGCCAGGCACTATGCTAGG + Intergenic
1097983533 12:65758650-65758672 CCAGATCCAGGCAGCCTACTGGG - Intergenic
1099263613 12:80415853-80415875 CAAGTGCCAGGCACTCTTCTAGG - Intronic
1100261468 12:92936132-92936154 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1101561678 12:105863137-105863159 CCAGACCCAGGCACTGTGCTGGG + Intergenic
1101595552 12:106161469-106161491 TGAGACCCTGGCACCGTGCTAGG + Intergenic
1101842774 12:108340000-108340022 CGACAGCCAGGCAGCGTGCTAGG + Intergenic
1102004401 12:109580074-109580096 CATGTGCCAGGCACCCTGCCAGG + Intronic
1102111928 12:110371488-110371510 CCAGAGCCCGCCTCCCTGCTTGG + Intergenic
1102600592 12:114026811-114026833 CAAGTGGCAGGCACCATGCTGGG + Intergenic
1102689038 12:114746170-114746192 CATGTGCCAGGCACCATGCTAGG + Intergenic
1102919915 12:116784239-116784261 TGAGAGCCAGGGAGACTGCTAGG - Intronic
1104872975 12:132014030-132014052 GGAGACCGAGGCACCCTCCTGGG + Intronic
1104892701 12:132148120-132148142 GGAGAGCCGGGCACCCTCCCGGG + Intronic
1105348659 13:19596993-19597015 AGAGTACCAGGCACCCTGCATGG + Intergenic
1105972574 13:25443816-25443838 TGGGTGCCAGGCACCCTTCTAGG - Intronic
1106197606 13:27507656-27507678 TGTGTGCCAGGCACTCTGCTAGG - Intergenic
1107132146 13:36908019-36908041 TGAAAGGCAGGCAGCCTGCTGGG - Intronic
1108406924 13:50113631-50113653 TGTGAGCCAGGCACTATGCTAGG - Intronic
1110001116 13:70202298-70202320 CAAGAGCCTGGCACCCAGCATGG + Intergenic
1110058882 13:71015747-71015769 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1112417846 13:99218598-99218620 CCTGAGCCAGGCACTCTGCCCGG + Intronic
1112576953 13:100644471-100644493 TGAGAGCCAGGGGCCCAGCTGGG - Intronic
1113161924 13:107391540-107391562 TAAGAGCCAGGCACCCTTTTAGG + Intronic
1114552766 14:23543177-23543199 CATGGGCCAGGCACCGTGCTAGG + Intronic
1115752942 14:36508441-36508463 CGAGAGCGAGGCTGCCGGCTGGG + Intronic
1118243089 14:64080867-64080889 CAAGAGCCAGGCAAACTGTTGGG + Intronic
1119130208 14:72165096-72165118 AAAGAGCCAGGAACCCTGCTAGG + Intronic
1119412489 14:74442164-74442186 CGTGAGCCAGGCACTGTGCTAGG + Intergenic
1119686361 14:76635311-76635333 CGAGATCCAGGCAGCCTTCTGGG - Intergenic
1120771354 14:88383873-88383895 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1121235188 14:92386973-92386995 TGAGAGCAGGGCACCCTGCTGGG - Intronic
1121299842 14:92861615-92861637 CAGAAGCCAGGCACCCTGCAAGG - Intergenic
1121638092 14:95467232-95467254 CAAGAGCGAGGCACACTGCTTGG - Intronic
1121698433 14:95932166-95932188 TGTGTGCCAGGCACCATGCTAGG + Intergenic
1122353867 14:101112168-101112190 TGAGTGCCAGGCACCGTTCTGGG - Intergenic
1122484912 14:102072654-102072676 CAGGCGCCAGCCACCCTGCTCGG - Intergenic
1122609838 14:102974463-102974485 CAAGGGCCAGGCACTGTGCTGGG - Intronic
1122772184 14:104102453-104102475 GGAGAGCCCGGCACGGTGCTGGG - Intronic
1122900165 14:104779105-104779127 GGAGACCCAGGCGCCCTGCTAGG - Intronic
1122910679 14:104826449-104826471 CCAGAGCCTGGCGTCCTGCTGGG + Intergenic
1123441691 15:20296059-20296081 CGTGTGCCAGGCACCATGCCAGG - Intergenic
1124210786 15:27763687-27763709 TGGGAGGCAGGCACCCTCCTGGG + Intronic
1124625526 15:31305492-31305514 GGGGACCCAGGCAGCCTGCTGGG - Intergenic
1125274674 15:37978160-37978182 CCTGAGCCAGGAGCCCTGCTTGG + Intergenic
1126233495 15:46354605-46354627 CCAGAGCCAGGGACCCCACTTGG - Intergenic
1126645036 15:50867414-50867436 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1126646017 15:50875459-50875481 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1126861341 15:52885915-52885937 CCAGATCCAGGCAACCTTCTGGG + Intergenic
1128788194 15:70413555-70413577 CGAGTGCCAGGCATCGTGCTGGG + Intergenic
1129187973 15:73922281-73922303 CAAGGGCCTGGCGCCCTGCTTGG + Intergenic
1130644908 15:85715872-85715894 GGAGAGCGAGACACTCTGCTGGG - Exonic
1130808167 15:87349041-87349063 TGAAGGCCAGGCACTCTGCTAGG - Intergenic
1130861595 15:87895660-87895682 TAAGAGCCAGGCACCCTTTTAGG + Intronic
1131676536 15:94675893-94675915 AGTGAGCCAGGCACCCTGATAGG - Intergenic
1131871690 15:96770519-96770541 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1132554519 16:566674-566696 CCAGACCCAAGGACCCTGCTTGG + Intergenic
1133285245 16:4687725-4687747 CGAGGCCCATGCAGCCTGCTGGG + Intronic
1133730021 16:8570718-8570740 CGTGGGCCAGGCACCGTTCTCGG - Intronic
1133858350 16:9570980-9571002 CAAGACCCAGGCTCCCTGCTGGG + Intergenic
1136005177 16:27324455-27324477 TGTGTGCCAGGCACCGTGCTAGG + Intronic
1136516599 16:30772351-30772373 TGTGAGCCAGGCACAGTGCTTGG + Intronic
1136842864 16:33553891-33553913 CGTGTGCCAGGCACCATGCCAGG + Intergenic
1137236289 16:46621173-46621195 CGCGACCCAGGCGCCCTCCTAGG + Intronic
1137309450 16:47239710-47239732 TGAGAACCAGGCATTCTGCTGGG - Intronic
1137598206 16:49738688-49738710 AGAGAGCCAGGAACACTGCCAGG + Intronic
1138114906 16:54352611-54352633 CACGTGCCAGGCACTCTGCTAGG + Intergenic
1138224317 16:55279449-55279471 CAAGAGACAGGAAGCCTGCTGGG + Intergenic
1138375802 16:56563260-56563282 CAAGGGCCAGGCACTGTGCTGGG - Intergenic
1138991525 16:62395866-62395888 CAAGTGCCAGGCACTATGCTAGG + Intergenic
1138995372 16:62445353-62445375 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1139278963 16:65753390-65753412 TGAGAGCCAAGCACACTGCCAGG + Intergenic
1139368754 16:66451636-66451658 TATGAGCCAGGCATCCTGCTAGG + Intronic
1139393870 16:66624235-66624257 TGTGGGCCAGGCACCATGCTGGG - Intronic
1140412975 16:74752659-74752681 TCTGTGCCAGGCACCCTGCTTGG - Intronic
1140489805 16:75325655-75325677 CAAGTGCCAGGCACCCTGCCGGG - Intronic
1140527789 16:75637837-75637859 CAACAGCCAGGCTCCCTTCTAGG + Intronic
1141608421 16:85168719-85168741 CTAGATGCAGGCACCCTGCCGGG - Intergenic
1141617503 16:85218460-85218482 GGAGTGCCAGGCACACTTCTGGG + Intergenic
1203148065 16_KI270728v1_random:1816015-1816037 CGTGTGCCAGGCACCATGCCAGG + Intergenic
1203153029 16_KI270728v1_random:1854189-1854211 CGTGTGCCAGGCACCATGCCAGG + Intergenic
1142476977 17:194403-194425 CATGAGCCAGGCACCAGGCTAGG - Intergenic
1143986349 17:10917898-10917920 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1144095803 17:11899863-11899885 TAAGTGCCAGGCACCCTGCTAGG + Intronic
1144212772 17:13029353-13029375 TGTGTGCCAGGCATCCTGCTAGG + Intergenic
1144287219 17:13788465-13788487 CCAGAGCCAGGCAAGCTGTTAGG + Intergenic
1145766223 17:27459933-27459955 GAAGAGTCAGGCACGCTGCTAGG - Intronic
1146687332 17:34849813-34849835 TGAGTGCCAGGCACTGTGCTAGG + Intergenic
1147267811 17:39245316-39245338 CGAGAGCCTAGCACAATGCTGGG - Intergenic
1147988066 17:44317913-44317935 CCTGTGCCAGGCACCGTGCTGGG - Intronic
1148847488 17:50537927-50537949 AGAGTGCCTGGCACACTGCTTGG + Intronic
1149775153 17:59351420-59351442 GTAGAGCCAAGTACCCTGCTTGG - Intronic
1150163026 17:62915311-62915333 CGTGTACTAGGCACCCTGCTAGG - Intergenic
1150649685 17:67001631-67001653 TGGGTGCCAGGCACCATGCTAGG - Intronic
1150659751 17:67064979-67065001 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1151297671 17:73197461-73197483 CGTGTGCCAGCCACCATGCTAGG + Intronic
1151956754 17:77384002-77384024 CTAGGGCCTGGCACCCTGCCTGG - Intronic
1152038855 17:77890475-77890497 CCCTTGCCAGGCACCCTGCTGGG + Intergenic
1152512383 17:80799088-80799110 CTAGAGCCAGAGAACCTGCTTGG + Intronic
1153098585 18:1437901-1437923 CATGTGCCAGGCACCATGCTAGG - Intergenic
1154089373 18:11343359-11343381 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1155100253 18:22604039-22604061 TGAGTGCCAGGCACTCTTCTAGG - Intergenic
1155146222 18:23085935-23085957 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1157221905 18:45834286-45834308 TGAGAGGCAGGTACCATGCTGGG + Intronic
1157393252 18:47320735-47320757 CAAGAGCCTGGCACTCTGATGGG - Intergenic
1157428760 18:47606016-47606038 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1158170945 18:54598813-54598835 TAAGAGCCAGGCACCCTTTTAGG + Exonic
1160311403 18:77794450-77794472 TGTGTGCCAGGTACCCTGCTAGG + Intergenic
1160613453 18:80107240-80107262 TGTGTGCCAGGCACCGTGCTGGG - Intergenic
1163379715 19:16957176-16957198 GCAGAGCCAGGCACGCAGCTGGG - Intronic
1163684065 19:18700695-18700717 CCAGTCCCAGGCGCCCTGCTAGG - Intronic
1164287141 19:23827491-23827513 CCAGATCCAGGCAGCCTTCTGGG + Exonic
1164720694 19:30429712-30429734 GCAGAGCCAGGCACCGTGCCTGG + Intronic
1165014832 19:32873131-32873153 AGAGAACAAGGCACCCAGCTGGG - Intergenic
1166764818 19:45246426-45246448 TGAGGGCCAGGCACGCAGCTAGG - Intronic
1166807408 19:45495726-45495748 CCTGAGCCAGGCACCATGCTTGG + Intronic
1168093440 19:54100670-54100692 GGAGACCCAGACACCCTGCAGGG - Intronic
1168619424 19:57866100-57866122 CTACAGACAGGCACCCTGCCTGG + Intronic
925953462 2:8937811-8937833 CATGCGCCAGGCACTCTGCTAGG + Intronic
926305329 2:11633975-11633997 CCAGGGCCAGGCACCCTGCTGGG - Intronic
927068015 2:19493246-19493268 TGAGAGCCAGACACTGTGCTGGG - Intergenic
927776201 2:25905463-25905485 TGTGGGCCAGGCACCATGCTAGG - Intergenic
928329782 2:30348772-30348794 CGAGTACCAGGCACTGTGCTTGG + Intergenic
928401001 2:30978755-30978777 TGAGTGCCAGGCACCGTGCTAGG + Intronic
928890007 2:36193652-36193674 TGAGGGCCAGGCACCTTGCTAGG + Intergenic
929572046 2:43028761-43028783 CCAGAGCCCAGCACACTGCTGGG - Intergenic
929824562 2:45300063-45300085 CAAGCTCCAGGAACCCTGCTTGG + Intergenic
931423825 2:62152567-62152589 GAGGAGCCAGGCACCATGCTAGG - Intergenic
932501353 2:72185545-72185567 GGAGAGACAGGCACACTGGTTGG + Intronic
934626296 2:95857840-95857862 TGAGACCCAGGCACCCTTTTGGG + Intronic
934649989 2:96085249-96085271 CCAGTGCCAGGCGCCCAGCTAGG + Intergenic
934807267 2:97243476-97243498 TGAGAGCCAGGCACCCTTTTGGG - Intronic
934830242 2:97513711-97513733 TGAGAGCCAGGCACCCTTTTGGG + Intronic
936919160 2:117670111-117670133 TGAGTACCAGGCACCATGCTAGG + Intergenic
937059164 2:118968852-118968874 ACAGGGCCAGGCACCATGCTGGG + Intronic
937059497 2:118970915-118970937 CCAGAGCAAGGAACCCTGCTGGG - Intronic
940398735 2:153222540-153222562 CAAGAGGCAGACAGCCTGCTGGG - Intergenic
940721165 2:157283771-157283793 CCTGTGCCAGGAACCCTGCTAGG + Intronic
940737848 2:157473248-157473270 CCATTGCCAGGCACTCTGCTAGG - Intronic
941006652 2:160254516-160254538 GGTGAGCCAGGCCCCCTGCTTGG + Intronic
943653020 2:190477623-190477645 TAAGAGCCAGGCAGCATGCTGGG + Intronic
943957602 2:194212710-194212732 CTAGTGCCAGGCACCATTCTCGG + Intergenic
945451675 2:210002041-210002063 TGAGCACCAGGCATCCTGCTGGG + Intergenic
946007855 2:216540866-216540888 CTATAGCCAGGCACTGTGCTAGG - Intronic
948819767 2:240535444-240535466 TAAGAGCCAGGCACCCTTTTAGG - Intronic
948889106 2:240898176-240898198 CTAGAGCCAGGCACGATGCCAGG + Intergenic
949030053 2:241790787-241790809 TAAGAGCCAGGCACCCTTTTAGG + Intronic
1168747203 20:253798-253820 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1169586090 20:7086981-7087003 CAGAAGCCAGGCACCCTGCTAGG - Intergenic
1171079870 20:22168543-22168565 AGAGCTCCAGGAACCCTGCTTGG + Intergenic
1171291409 20:23984907-23984929 GGAGAGCCAGGCACATGGCTGGG - Intergenic
1171374587 20:24683754-24683776 TGTGTGCCAGGCACTCTGCTGGG + Intergenic
1172021857 20:31920272-31920294 TGAGTGCCAGGCACTGTGCTGGG - Intronic
1172434404 20:34918892-34918914 TGAGTGCCAGGCACTTTGCTAGG + Intronic
1172655123 20:36532141-36532163 CGTGAGCCAGCCACCGTGCCCGG - Intergenic
1174039730 20:47690357-47690379 TACGTGCCAGGCACCCTGCTAGG + Intronic
1174221002 20:48955488-48955510 CGTGTGCCAGGCACCATTCTAGG - Intronic
1174285086 20:49467040-49467062 TGTGGGCCAGGCAACCTGCTGGG - Intronic
1175138858 20:56844764-56844786 CCAGAGCTAAGCACCATGCTTGG + Intergenic
1175199710 20:57268517-57268539 CCAGGGCCAAGCACCATGCTGGG + Intergenic
1175221830 20:57421606-57421628 CCAGTGCCCGGCACCCTGCCTGG + Intergenic
1175415362 20:58797267-58797289 TGAGTGCCAGGCACAGTGCTGGG - Intergenic
1175888132 20:62303593-62303615 CGAGAGCCTGGCACCAGGCTTGG - Exonic
1175936560 20:62516922-62516944 CCAGAGCCACTCACCCTGCACGG + Intergenic
1176095362 20:63341106-63341128 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1176179954 20:63745129-63745151 CCAGAGCCACCCACCTTGCTCGG + Exonic
1176361344 21:5999296-5999318 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1178031713 21:28535244-28535266 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1178329888 21:31678939-31678961 TGTGTGCCAGGCACCCTTCTAGG - Intronic
1178664543 21:34534848-34534870 CCAGTGCCTGGCATCCTGCTAGG - Intronic
1178760681 21:35399489-35399511 AGAGAGCCAGGCACTCTCCTCGG + Intronic
1179482183 21:41685452-41685474 CCAGCGCCTGTCACCCTGCTGGG + Intergenic
1179619418 21:42603084-42603106 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1179762174 21:43539254-43539276 TAAGAGCCAGGCACCCTTTTAGG + Intronic
1180747841 22:18103730-18103752 TGAGAGCCTGGCAGCCTGCCCGG + Exonic
1180765989 22:18346186-18346208 GGAGAGCCAGGCACATGGCTGGG + Intergenic
1180844496 22:18973784-18973806 TGTGAGCCAGGCGCCCTGCCCGG + Intergenic
1180907305 22:19423405-19423427 CAAGAGCCTGGCATGCTGCTTGG + Intronic
1181068367 22:20317162-20317184 CGGGAGCCAGGCTACCTGCAGGG - Intronic
1181400547 22:22648028-22648050 GGAGAGCCAGGCACATGGCTGGG + Intergenic
1181702529 22:24629126-24629148 GGAGAGCCAGGCACATGGCTGGG + Intergenic
1181949186 22:26541852-26541874 TGTGTGCCTGGCACCCTGCTGGG + Intronic
1181957819 22:26601020-26601042 TGTGAGCCAGGCACTGTGCTAGG - Intronic
1182091733 22:27600441-27600463 TGAGTGCCAGGCACTGTGCTAGG + Intergenic
1182228027 22:28815183-28815205 TGTGTGCCAGGCACTCTGCTAGG - Intergenic
1182356080 22:29722752-29722774 CGAGACCCAGGCCCTCTGCCGGG + Intronic
1182360203 22:29741929-29741951 CAAGAGTGAGGCACCATGCTCGG + Intronic
1182911038 22:33984889-33984911 CAAGTGCCAGGCACCATGCTGGG + Intergenic
1182970893 22:34575581-34575603 CCAGCGCCTGGCCCCCTGCTTGG - Intergenic
1182973768 22:34603165-34603187 GGAGAGCCTGGCAACCTCCTAGG - Intergenic
1183086369 22:35489633-35489655 CCACAGCCAGGCACCCTACTGGG + Intergenic
1183362524 22:37390065-37390087 CCAGAGCCATGCAGCCTGTTGGG - Intronic
1184737484 22:46407956-46407978 CGAGGGCCGGGCACCCTCCTGGG + Intronic
1184782667 22:46656965-46656987 CCACAGCCAGGCAGCCTTCTGGG + Intronic
1184887290 22:47354139-47354161 TGAGGCCCAGACACCCTGCTAGG - Intergenic
950151869 3:10693770-10693792 CCAGAGCCTGGCACACTGCCTGG + Intronic
950656860 3:14441877-14441899 CCAGAGCCAGGCGCCATGCCTGG - Intronic
952223564 3:31350504-31350526 TGAGAGACAGGCAAGCTGCTGGG + Intergenic
952398799 3:32944883-32944905 CGTGAGCCATGCACCCCGCCTGG - Intergenic
952858382 3:37792252-37792274 TAAGAGCCAGGCACTGTGCTAGG + Intronic
955065110 3:55527066-55527088 CTAGTGCCAGGCACTGTGCTAGG - Intronic
955613009 3:60777546-60777568 TAAGAGCCAGGCACCCTTTTAGG - Intronic
955856577 3:63278913-63278935 CAAAATCGAGGCACCCTGCTTGG + Intronic
955871962 3:63448703-63448725 CATGTGCCAGGCACCATGCTAGG + Intronic
956452152 3:69385776-69385798 CGAGTGCCCGGCATCCTGCTGGG + Intronic
956606674 3:71079761-71079783 TGAGAGCCAGGCACTGTGCTGGG - Intronic
956728497 3:72176458-72176480 CCAGAGCCTGGCACACTGCTTGG + Intergenic
956753958 3:72367456-72367478 CCAGGGCCAGCCATCCTGCTGGG - Intergenic
958720768 3:97839942-97839964 CCAGAGCCTGGCACCCCGCCTGG - Intronic
959116859 3:102188816-102188838 TGAGTGCCAGGCACTGTGCTGGG + Intronic
961732214 3:128974147-128974169 CTTGAGCCAGGCTCTCTGCTGGG - Intronic
961796679 3:129414157-129414179 AGAGAGGCAGAGACCCTGCTTGG + Intronic
963301670 3:143604304-143604326 CCAGAGCTTCGCACCCTGCTTGG - Intronic
963353570 3:144182009-144182031 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
967219646 3:187237731-187237753 CAAGACCCAAGCACCCTGCCTGG - Intronic
968227904 3:196987207-196987229 CCAGATCCAGGCAGCCTTCTGGG - Intergenic
968967969 4:3778917-3778939 CTAGCACCAGGCACCCTGCCAGG - Intergenic
968983140 4:3861428-3861450 CAAGGCCCAGGCACCATGCTGGG - Intergenic
969514747 4:7640786-7640808 CCAGAGCCAGGCCTCCTACTGGG - Intronic
970339544 4:15090758-15090780 CAAGAGCCAGGAACCATGCAAGG - Intergenic
970600340 4:17636905-17636927 CAAGAGCCAGGGATGCTGCTGGG + Intronic
970764668 4:19533032-19533054 CCATAACCAGGCACCCTGCTAGG + Intergenic
971188379 4:24402919-24402941 TGAGAGCCAGGCATCATACTAGG - Intergenic
971333197 4:25699513-25699535 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
971451039 4:26802321-26802343 CAAGTGCCAGTCACCATGCTGGG - Intergenic
972400199 4:38694530-38694552 CATGAGCCAGGCACTGTGCTTGG - Intronic
973218122 4:47694699-47694721 TGAGTGCCAGGCACTCCGCTGGG - Intronic
979464264 4:121018128-121018150 CGTGACCCAGGCACCATGCTAGG - Intergenic
982258667 4:153474174-153474196 TGAGTGCCAGGCACCGTGCTGGG + Intronic
984508426 4:180650499-180650521 GGAGAGCCAGGCACTGTGATAGG - Intergenic
985606865 5:862476-862498 CGGGAGGCAGCCACCCTGCCCGG - Intronic
985682512 5:1264009-1264031 CGAGACCCTGGGGCCCTGCTGGG - Intronic
987776316 5:22372317-22372339 AGGGAACCAGGCAGCCTGCTTGG + Intronic
988365586 5:30294397-30294419 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
988455558 5:31384241-31384263 GAAGAGCCAGGCACTGTGCTAGG + Intergenic
989135858 5:38154046-38154068 TAAGAGCAAGGCACTCTGCTAGG + Intergenic
989391911 5:40909507-40909529 AGAGAGGCAGGCAGCCTGCTGGG + Exonic
990346133 5:54873589-54873611 CGTGTGCCAGGCACTGTGCTAGG - Intergenic
990988301 5:61661201-61661223 CAAGTGCCAGGCACTGTGCTGGG + Intronic
992533071 5:77671025-77671047 TGTGTGCCAGGCACCATGCTAGG - Intergenic
992856195 5:80863916-80863938 TAAGAGCCAGGCACCCTTTTAGG - Intronic
993330870 5:86598362-86598384 AGAAAGTCAGGCAGCCTGCTTGG + Intergenic
995823291 5:116263533-116263555 TAAGAGCCAGGCACCCTTTTAGG + Intronic
995860023 5:116630837-116630859 CCATAGGCAGGCACCCTGATGGG + Intergenic
996964769 5:129294794-129294816 TAAGAGCCAGGCACCCTGTTAGG - Intergenic
997803543 5:136890657-136890679 TATGAGCCAGGCACCATGCTAGG + Intergenic
997826424 5:137110805-137110827 CTAGTGCCAGGCACTGTGCTAGG - Intronic
998195013 5:140061313-140061335 TGAGTGCCAGGCACTCTTCTGGG - Intergenic
999434287 5:151550959-151550981 TGAGTGCCAGGCACTGTGCTAGG - Intronic
999874189 5:155784160-155784182 TGAGAGCCTGGCACCCCTCTAGG + Intergenic
1000770538 5:165348078-165348100 AGTGAGCCTGACACCCTGCTAGG + Intergenic
1001210992 5:169810072-169810094 CAAGAGCCAGGCATTGTGCTGGG - Intronic
1001214783 5:169845452-169845474 TGCACGCCAGGCACCCTGCTGGG - Intronic
1001297900 5:170511631-170511653 CCAGTGCCAGGCACCTTGCTCGG + Intronic
1001740854 5:174051620-174051642 TGTGAGCCAGGCACTGTGCTAGG + Intronic
1001913771 5:175542418-175542440 GGAGACGCAGGCACCCTGCTGGG - Intergenic
1002133002 5:177092752-177092774 CGTGAGCCAGGCAGACTGGTAGG - Exonic
1003195128 6:3907545-3907567 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1005971271 6:30763836-30763858 CCAGAGCCAGGCAGGCAGCTCGG + Intergenic
1006455278 6:34128322-34128344 TGTGTGCCAGGCACCATGCTAGG + Intronic
1006466548 6:34198009-34198031 CGAGTGCCAGGTACTCTGCTGGG + Intergenic
1007767822 6:44171357-44171379 CTAGCTCCAGGGACCCTGCTGGG + Intronic
1008899103 6:56590939-56590961 CGGGAAACAGGTACCCTGCTGGG - Intronic
1014177531 6:118347095-118347117 GGACAGCTAGTCACCCTGCTTGG - Intergenic
1014746755 6:125209449-125209471 CAAGAGCCAGAGACCCTTCTGGG - Intronic
1014931109 6:127337279-127337301 TAAGAGCCAAGCACCCTTCTAGG + Intronic
1014991869 6:128089825-128089847 CGAGAGCAAGGCAGACTGTTTGG - Exonic
1016159477 6:140859915-140859937 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1016829553 6:148420466-148420488 TAAGTGCCAGGCACTCTGCTGGG + Intronic
1016854005 6:148648239-148648261 CCAGACCCAGGCAGCCTTCTGGG - Intergenic
1016895761 6:149050957-149050979 CCAGAGCCAGGGAGACTGCTGGG + Intronic
1017014631 6:150090130-150090152 CGTGTGCCAGGCACTGTGCTGGG - Intergenic
1018047691 6:159979659-159979681 AGTGAACCAGGCACCCTGGTGGG + Intronic
1018680550 6:166260896-166260918 CGAGTGCCAGGCTCCATGCTGGG + Intergenic
1019929481 7:4214322-4214344 GGAGAGACAGGCCCCCTACTCGG - Intronic
1019947782 7:4343705-4343727 AGTGAGCCAGACACGCTGCTAGG - Intergenic
1020503401 7:8952604-8952626 CGAGAGACTGGTTCCCTGCTGGG - Intergenic
1020985335 7:15126839-15126861 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1022673634 7:32478500-32478522 AAAGAGCCAGGCACCCTGGCAGG + Intergenic
1023083451 7:36546881-36546903 CTAGAGCCTGGCACAGTGCTTGG + Intronic
1023822406 7:43987571-43987593 GGGGACCCAGGCATCCTGCTGGG + Intergenic
1023936007 7:44740187-44740209 CCAGGGCAAGTCACCCTGCTGGG + Intergenic
1024139807 7:46450623-46450645 TGGAAGCCAGGCACGCTGCTAGG + Intergenic
1026964112 7:74428381-74428403 CCAAAGCCAGGCAACCAGCTTGG - Intergenic
1027173684 7:75889935-75889957 TGAGTGCCAGGCCCCATGCTAGG - Intergenic
1028482532 7:91323306-91323328 TGGGTGCCAGGCACCATGCTAGG + Intergenic
1029306122 7:99621427-99621449 TGGGAGCCAGGCATCCAGCTGGG + Exonic
1029607219 7:101606293-101606315 CAAGACCCAGGCATCTTGCTGGG + Intergenic
1029750669 7:102540986-102541008 GGGGACCCAGGCATCCTGCTGGG + Intronic
1029768624 7:102640097-102640119 GGGGACCCAGGCATCCTGCTGGG + Intronic
1030118081 7:106078851-106078873 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1030298345 7:107951250-107951272 CGAGTGCCAGGAACTCTTCTGGG - Exonic
1033989024 7:147262028-147262050 CGTGAGCCAGGCACTGTGTTAGG + Intronic
1035195712 7:157218675-157218697 CTGGAGCCAAGCACCCTGCCAGG - Intronic
1035346280 7:158201594-158201616 CAAGAGCCAGGCACCCTTTTAGG + Intronic
1035494549 7:159311995-159312017 CAAGAGCAAGCCACCATGCTTGG - Intergenic
1036637630 8:10562864-10562886 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1037142625 8:15537089-15537111 TAAGAGCCAGGCACCCTTTTAGG + Intronic
1037608733 8:20458861-20458883 CCAGGGCCTGGTACCCTGCTGGG + Intergenic
1037777000 8:21842130-21842152 CCAGAACCAAGCACTCTGCTAGG - Intergenic
1038454757 8:27665873-27665895 CAAGAGCCAAGCACTCTGCCGGG - Intronic
1038495157 8:27996292-27996314 TGTGCGCCAGGCACCCTGCTAGG - Intergenic
1038529678 8:28308173-28308195 TTAGTGCCAGGCACCATGCTAGG - Intergenic
1039339020 8:36626568-36626590 TGAGGACCAGGCACACTGCTAGG - Intergenic
1039591676 8:38755363-38755385 CAAGAACCAGGCACTGTGCTGGG + Intronic
1039935888 8:42044754-42044776 TGTGGGCCAGGCACTCTGCTTGG - Intronic
1040111554 8:43569083-43569105 GGAGAGACATGCACCCTGGTGGG + Intergenic
1040112181 8:43571469-43571491 GGAGAGACATGCACCCTGGTTGG + Intergenic
1040331074 8:46386075-46386097 AGAGACACAGGCACCCTACTCGG - Intergenic
1040558372 8:48501024-48501046 TGAGGGCCAAGGACCCTGCTTGG + Intergenic
1041767553 8:61434802-61434824 TGAGAACCAGGCACCCTTTTAGG - Intronic
1042370588 8:67986672-67986694 CGAAAGAAAGGCACCATGCTGGG - Intronic
1042875673 8:73438248-73438270 GGAGAACCAGGCACCACGCTGGG + Intronic
1043855122 8:85255979-85256001 CATGTGCCAGGCACCATGCTAGG - Intronic
1045222349 8:100211512-100211534 TGAGAGCCAGCCACCATGCCTGG - Intronic
1045888173 8:107123802-107123824 CAAAAGCCAGGCACACTGCTAGG + Intergenic
1046985180 8:120380149-120380171 CATGAGCCAGGCACTGTGCTGGG + Intergenic
1047533800 8:125700842-125700864 TGCGATCCAGGCAACCTGCTGGG - Intergenic
1047739122 8:127793288-127793310 GGGGAGTCAGGCACCCAGCTAGG - Intergenic
1049059349 8:140264155-140264177 TGAGAGCTACCCACCCTGCTGGG - Intronic
1049637577 8:143697337-143697359 CAAGAGCAAGGCAGCCCGCTTGG - Intronic
1049678496 8:143904235-143904257 CGAGGCCCAGCCACCGTGCTGGG + Intergenic
1050715472 9:8519620-8519642 CGAGTGCCAGGCAGCATTCTAGG - Intronic
1051581768 9:18683815-18683837 AGAGAGCCAGGCTCACTCCTTGG - Intronic
1052121936 9:24729074-24729096 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1052800862 9:32966726-32966748 CCAGAGACAGGCATCCTGCAAGG - Intergenic
1053114826 9:35490918-35490940 CATGTGCCAGGCACCGTGCTGGG - Intronic
1053312538 9:37028539-37028561 AGAGGGCCAGCCACTCTGCTTGG - Intronic
1054737452 9:68769843-68769865 TGGGTGCCAGGTACCCTGCTAGG - Intronic
1056642166 9:88380844-88380866 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1057349320 9:94281939-94281961 TAAGAGCCAGGCACCCTTTTAGG - Intronic
1060418999 9:123454183-123454205 TGTGTGCCAGGCACCCTGCTGGG - Intronic
1060484586 9:124039130-124039152 TGAGTGCCAGGCCCTCTGCTGGG + Intergenic
1060784892 9:126443313-126443335 TGAGGGCCAGGCACCCTGCAGGG + Intronic
1061171793 9:128961899-128961921 CGTGAGCCAGCCACCATGCCCGG + Intronic
1061326402 9:129867369-129867391 TGAGACCCAGGCAGCCTGCAGGG + Intronic
1061592539 9:131607283-131607305 CGGGGGGCAGACACCCTGCTTGG + Intronic
1061932037 9:133838309-133838331 CTAGCGCCAGGCACTGTGCTAGG - Intronic
1062190304 9:135244547-135244569 CGTGAGGCAGGCAGGCTGCTCGG + Intergenic
1062217801 9:135398747-135398769 CTTGTGCCAGGCACCCTGCCAGG + Intergenic
1185599787 X:1330906-1330928 CGTGAGCCACGCACCCAGCAGGG - Intergenic
1185660647 X:1726197-1726219 TAAGAGCCAGGCACCCTTTTAGG - Intergenic
1185712289 X:2314103-2314125 TGAGAGCCAGGCCCCCTTTTAGG - Intronic
1186727730 X:12374960-12374982 CCAGAGCCAGACACTCTGCTAGG - Intronic
1186951282 X:14628405-14628427 CTAGAGCCAGCCACAGTGCTTGG + Intronic
1188439617 X:30202486-30202508 TAAGAGCCAGGCACCCTTTTAGG + Intergenic
1189164680 X:38849286-38849308 AGAGTCCCAGGCACCCTTCTGGG + Intergenic
1189368408 X:40407996-40408018 TGAGAATCAGTCACCCTGCTAGG + Intergenic
1189446213 X:41084587-41084609 CGAGGGCCTGGCCACCTGCTTGG - Intergenic
1191223649 X:58017046-58017068 CATGAGCCAGGAGCCCTGCTTGG - Intergenic
1191256216 X:58280738-58280760 GGAGAGACACGCACCCAGCTTGG + Intergenic
1192181251 X:68917114-68917136 CGAGAGGCAGGGACACTGGTGGG + Intergenic
1192455216 X:71270296-71270318 CAAGAGCCTGGCAAACTGCTTGG - Intergenic
1192478088 X:71460913-71460935 CTAGGGCCAGGCACTGTGCTAGG + Intronic
1193809649 X:86036512-86036534 TAAGAGCCAGGCACCCTTTTAGG - Intronic
1194953851 X:100156419-100156441 CCAGATCCAGGCAGCCTTCTGGG - Intergenic
1195521710 X:105838076-105838098 TGAGTGCCAGGCACTGTGCTAGG - Intronic
1196210964 X:112995231-112995253 TGTGTGCCAGACACCCTGCTAGG + Intergenic
1197821499 X:130545221-130545243 CGAGAGCCATGCTCCCAGCCAGG + Intergenic
1198735963 X:139785644-139785666 GGAGTGCCAGGCACAGTGCTAGG + Intronic
1200247505 X:154533971-154533993 GCAGAGCCAGTCACCCTGCAGGG - Intronic