ID: 1068931452

View in Genome Browser
Species Human (GRCh38)
Location 10:62594495-62594517
Sequence CTGGCTCTCGGCTGATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931446_1068931452 -3 Left 1068931446 10:62594475-62594497 CCCACTACCTAGCAGGGTGCCTG 0: 1
1: 0
2: 9
3: 113
4: 599
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931449_1068931452 -10 Left 1068931449 10:62594482-62594504 CCTAGCAGGGTGCCTGGCTCTCG 0: 1
1: 0
2: 1
3: 52
4: 389
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931442_1068931452 16 Left 1068931442 10:62594456-62594478 CCGTACTCATCTGCCTATTCCCA 0: 1
1: 0
2: 1
3: 27
4: 290
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931447_1068931452 -4 Left 1068931447 10:62594476-62594498 CCACTACCTAGCAGGGTGCCTGG 0: 1
1: 0
2: 12
3: 102
4: 613
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data
1068931444_1068931452 3 Left 1068931444 10:62594469-62594491 CCTATTCCCACTACCTAGCAGGG 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1068931452 10:62594495-62594517 CTGGCTCTCGGCTGATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931452 Original CRISPR CTGGCTCTCGGCTGATGCTC TGG Intronic
No off target data available for this crispr