ID: 1068931624

View in Genome Browser
Species Human (GRCh38)
Location 10:62596220-62596242
Sequence CCATCTGCATGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068931624_1068931633 20 Left 1068931624 10:62596220-62596242 CCTTCTGCCCTCCATGCAGATGG 0: 1
1: 0
2: 4
3: 36
4: 308
Right 1068931633 10:62596263-62596285 AGACTTTTCATATGGCCCTGTGG No data
1068931624_1068931634 21 Left 1068931624 10:62596220-62596242 CCTTCTGCCCTCCATGCAGATGG 0: 1
1: 0
2: 4
3: 36
4: 308
Right 1068931634 10:62596264-62596286 GACTTTTCATATGGCCCTGTGGG No data
1068931624_1068931635 22 Left 1068931624 10:62596220-62596242 CCTTCTGCCCTCCATGCAGATGG 0: 1
1: 0
2: 4
3: 36
4: 308
Right 1068931635 10:62596265-62596287 ACTTTTCATATGGCCCTGTGGGG No data
1068931624_1068931632 12 Left 1068931624 10:62596220-62596242 CCTTCTGCCCTCCATGCAGATGG 0: 1
1: 0
2: 4
3: 36
4: 308
Right 1068931632 10:62596255-62596277 GTTTTATAAGACTTTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068931624 Original CRISPR CCATCTGCATGGAGGGCAGA AGG (reversed) Intronic
900122244 1:1053738-1053760 CCTTCTCGCTGGAGGGCAGAGGG - Exonic
900630290 1:3631518-3631540 CCATCTGCACGGGAGGCAGCAGG - Exonic
901342377 1:8506967-8506989 CCACCTCCATGGAGGCCAGCTGG + Intronic
902540543 1:17151136-17151158 CCATCTTGATGGAAGGCAAATGG - Intergenic
903014500 1:20353307-20353329 CCCTCTGTATGTAGGACAGATGG + Intronic
903175979 1:21580930-21580952 CCAGCTACTTGGAGGGCTGAGGG + Intergenic
903362523 1:22785622-22785644 CCATCTGCAGGGCAGACAGATGG + Intronic
904394264 1:30207737-30207759 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
905697441 1:39985668-39985690 CCATCTGCATGCAAGGCAGAGGG - Intergenic
907475255 1:54701160-54701182 CCTTCACCATGGAGGGCAGGAGG - Exonic
908395329 1:63720100-63720122 CCATCTGCCTGGTGAACAGAAGG - Intergenic
910904234 1:92157610-92157632 CCAGCTACTTGGAAGGCAGAAGG - Intergenic
913191738 1:116418724-116418746 CCGTCTGCAAGGAGAGCAGAGGG + Intergenic
913435668 1:118845037-118845059 ACATCTACATGGATGGCAGCAGG + Intergenic
913486951 1:119340362-119340384 TCAGCTGCTTGGAAGGCAGAGGG + Intergenic
915712803 1:157917455-157917477 CCATATGCATGGTAGGCTGATGG + Intergenic
915712879 1:157918038-157918060 CCATATGCATGGTAGGCTGATGG - Intergenic
916577065 1:166076900-166076922 CCATCTGCATGGAGAGGATCAGG + Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
917461509 1:175234490-175234512 CCATCAGGAGGGAGGCCAGAAGG + Intergenic
919291785 1:195642734-195642756 ACATCTACATGGATGGCAGCAGG + Intergenic
919340331 1:196298672-196298694 TCAACTCCAAGGAGGGCAGAGGG - Intronic
919973446 1:202595445-202595467 TCTCCAGCATGGAGGGCAGAGGG + Exonic
920693174 1:208162201-208162223 CCATTAGCAGGAAGGGCAGAAGG + Intronic
920746690 1:208635669-208635691 TCATCAGCAGGGAAGGCAGATGG - Intergenic
922749518 1:228064013-228064035 CCATCTGGGTGGAGAGCCGAAGG + Intergenic
922847177 1:228695854-228695876 CAATCTCCAGGGAGGGAAGAGGG - Intergenic
923103711 1:230838062-230838084 CCTTCTGCCTGGAGGGCATGGGG - Exonic
924824559 1:247525746-247525768 CAACCTCCATGGAGGGAAGAAGG - Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064356750 10:14625837-14625859 GCAGCTGCATGGAGGTCGGATGG - Intronic
1064805901 10:19132118-19132140 CCATCTTCAGGGGGAGCAGAGGG + Intronic
1066429199 10:35336415-35336437 CGATCTGCTTCCAGGGCAGAGGG + Intronic
1067053542 10:43038634-43038656 CCCACTGCATCCAGGGCAGAAGG - Intergenic
1067452622 10:46391638-46391660 CCCTCTGCATGCAGCACAGAAGG + Exonic
1067565443 10:47332648-47332670 CCATCTCCCTGGAGGGTGGAGGG + Intergenic
1067584610 10:47468117-47468139 CCCTCTGCATGCAGCACAGAAGG - Exonic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1070329740 10:75408686-75408708 CCATCTCCCTAAAGGGCAGAGGG + Intergenic
1070675545 10:78409162-78409184 CCAACTTCATGGAGGCCTGAAGG + Intergenic
1071294438 10:84209011-84209033 CAATCTGCAGGAGGGGCAGAGGG - Intronic
1072884811 10:99263699-99263721 CCATCTGCGTTGAGTGTAGAGGG - Intergenic
1072944660 10:99798929-99798951 CCATCTGCGTGGGGGCCTGAGGG - Intronic
1073240485 10:102054879-102054901 CCAGCTGCTTGGGGGGCTGACGG + Intronic
1073584332 10:104694166-104694188 CCTTCTTCTTGGTGGGCAGAGGG + Intronic
1073642690 10:105269230-105269252 CCATCTGCATGTAGGACACTGGG - Intergenic
1074078553 10:110150687-110150709 CCTCCTGCCTGGAGGGCAGCTGG + Intergenic
1074544323 10:114390780-114390802 CCATCTTCATGCAGAGCTGAGGG - Intronic
1076474786 10:130744316-130744338 TCATCTGCAGGGAGGGCAGAGGG - Intergenic
1076632436 10:131859076-131859098 CCCTCTGCAGGCAGGGCAAAGGG + Intergenic
1076817111 10:132920479-132920501 GCCTCTGCTTGGAGGGCAGCTGG - Intronic
1080998207 11:37632206-37632228 ACATATTCATGGAGTGCAGATGG + Intergenic
1081846693 11:46245730-46245752 CCATCCACATGGAAGGCTGAAGG + Intergenic
1083435434 11:62639758-62639780 CAATCAGCATGGAGGTCAGAAGG + Intronic
1083491019 11:63015181-63015203 CCAGCTGCACGGAGGGCTGTGGG + Intronic
1083828084 11:65214240-65214262 CCATCGTGATGGAGGTCAGAAGG + Intergenic
1083902555 11:65650667-65650689 CCAGCTGCTTGGAGGCCAGGAGG - Exonic
1084185311 11:67468215-67468237 CGTTCTGCGGGGAGGGCAGAGGG - Intronic
1084270936 11:68028811-68028833 CCACCTGCCTGGAGAGAAGAGGG - Exonic
1085619971 11:78030662-78030684 CCAGCCGCCTGGAGGGGAGAGGG - Intronic
1085773918 11:79348649-79348671 CCATCTGCAAGCTGGGGAGAAGG + Intronic
1086753455 11:90528849-90528871 CCAGCTGCATGGAAGGATGAAGG + Intergenic
1090279104 11:125441006-125441028 CCATCTGCATTTCGGGGAGAAGG + Intergenic
1094509640 12:31088482-31088504 CCATTTGCATGGAGGGCTATGGG + Intronic
1095692737 12:45108695-45108717 CCATCTGCAAGCAAGGAAGACGG + Intergenic
1095858390 12:46887199-46887221 CCATCTGGCTGAAGTGCAGAGGG + Intergenic
1098659274 12:73072451-73072473 CCACCAGCATGGAGGGGACAGGG + Intergenic
1100667643 12:96771828-96771850 CCTTCTCCATGCAGGACAGAAGG + Intronic
1101939453 12:109089241-109089263 ACATCTGGAGGGAGAGCAGAGGG - Intronic
1102099828 12:110269838-110269860 CAATCTGCATGGATGGGGGATGG - Intergenic
1102237938 12:111306414-111306436 CCATCTTCATCCAGGACAGAGGG + Intronic
1102624597 12:114224957-114224979 ATATCTACATGGAGGGCAGACGG + Intergenic
1103185288 12:118951654-118951676 GCATCTGCAAGGTTGGCAGAGGG + Intergenic
1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG + Intronic
1104013250 12:124946934-124946956 CCCTCACCATGGAGGACAGAAGG + Exonic
1104475092 12:129064522-129064544 ACATCTGCATGGAGCAGAGAAGG + Intergenic
1105012724 12:132766461-132766483 CCATCTGAAGTGAGGGCTGAAGG - Intergenic
1105940760 13:25146024-25146046 CAATCTCCAGGGAGGGGAGAGGG + Intergenic
1106631023 13:31473679-31473701 CAATCTCCAGGGAGGGAAGAAGG + Intergenic
1112389764 13:98972329-98972351 CCATCAGCATGGAGGGAGAATGG - Intronic
1113960302 13:114122361-114122383 CCATCTGCATGCAGAGCCCAGGG - Intronic
1117087678 14:52218542-52218564 CCAGCTACTTGGAAGGCAGAAGG + Intergenic
1118486541 14:66219624-66219646 CAAACTGCAGGGAGGGGAGAGGG - Intergenic
1119197551 14:72728408-72728430 CCAATGGCATGGAGGGAAGAAGG + Intronic
1119466443 14:74862583-74862605 CCATCTTCACCGAGGGAAGAAGG + Intronic
1119964138 14:78894533-78894555 CAATCTTCATGGATGGCTGAAGG - Intronic
1120771698 14:88386185-88386207 TCGTCTCCATGGAGAGCAGAGGG - Intronic
1121537100 14:94698463-94698485 TCAGCTGCAAGGAGGGCAGCTGG + Intergenic
1122743909 14:103887114-103887136 CCATCTGCCTGGAGGCTTGAGGG + Intergenic
1123004120 14:105313378-105313400 CCAGCTGCTCGGCGGGCAGAGGG - Exonic
1125769122 15:42153467-42153489 CCATCTGCATGTTGGGCGGCAGG - Intronic
1125887966 15:43242988-43243010 CCATCTGGGTGAAGGGCAGGGGG - Intronic
1126809540 15:52387361-52387383 CCATCTGGATGGAGTGCGTAAGG + Intronic
1127863908 15:63016206-63016228 CCAGCTCTATGGAGGACAGAGGG - Intergenic
1128142184 15:65310039-65310061 CCCCCAGCATGGAGGGAAGAGGG - Intergenic
1128231265 15:66037073-66037095 CCATCTGCATGCAGGGTAACAGG - Intronic
1128733943 15:70040686-70040708 CCATCTTCATGGTGGGAAAATGG - Intergenic
1128757187 15:70191087-70191109 CCATCTGCAGGGAGTGTAGCAGG + Intergenic
1129297721 15:74609038-74609060 GCATCTGCAGGGAGAGCAGATGG - Intronic
1129582853 15:76831091-76831113 CAAACTGCATGGAGCCCAGAGGG + Intronic
1129723615 15:77890837-77890859 CCATCTGAATACAGGGCAGAGGG - Intergenic
1130047047 15:80453696-80453718 CCATCAGTAGGGAGGGCAGTGGG - Intronic
1130556289 15:84924652-84924674 GCTACTGCATGGTGGGCAGAGGG + Intronic
1131095533 15:89652365-89652387 CCATCTCTATGGAGGTGAGAAGG + Intronic
1131458600 15:92602779-92602801 CCATCAGCATGGTCTGCAGAGGG + Intergenic
1132157075 15:99503130-99503152 CCATCTGCTTGGGGGGAGGAGGG + Intergenic
1132924104 16:2418470-2418492 CCAGCTACATGGAAGGCTGAGGG + Intergenic
1133065626 16:3204714-3204736 CCATCAGCAGGGTGTGCAGAAGG - Exonic
1134899849 16:17927596-17927618 CCATCAGTCTGGAGGGCAGAGGG + Intergenic
1135393907 16:22116569-22116591 CCATCTGCAGAGGAGGCAGAGGG + Intronic
1137568498 16:49549357-49549379 CCATCTGGCTGGAGGCCGGATGG - Intronic
1138027890 16:53537107-53537129 CCCTCTGCCAGGAGGTCAGAAGG - Intergenic
1138207099 16:55133150-55133172 CCATTTAGGTGGAGGGCAGAGGG + Intergenic
1138533216 16:57646282-57646304 CCCTCTGCACGGTGGGCAGTGGG - Intronic
1141382687 16:83589953-83589975 AAATGTGCAGGGAGGGCAGAGGG + Intronic
1142121789 16:88390156-88390178 CCCTCTGCCTGGAGAGCACAGGG - Intergenic
1142122967 16:88396388-88396410 CCATCTGAAGGGAGGCCAGGAGG + Intergenic
1142123066 16:88396685-88396707 CCGTCTGAAGGGAGGCCAGATGG + Intergenic
1142145801 16:88492507-88492529 CCATCCACATGCAGGACAGATGG - Intronic
1142557508 17:789912-789934 CCCTCTGCCTGGAGGGGAGAAGG - Intronic
1143023159 17:3927017-3927039 CACTCAGCATGCAGGGCAGAGGG - Intronic
1144465548 17:15493841-15493863 CCATCTGCAAGCCAGGCAGAGGG + Intronic
1145010455 17:19364918-19364940 CCATAGGCATGCAGGGAAGAGGG - Intronic
1145110693 17:20158718-20158740 TCATCTGCAAGGACTGCAGAGGG - Intronic
1146000359 17:29126921-29126943 CCCTGTGCTTGGATGGCAGATGG - Intronic
1146974516 17:37099431-37099453 AGATCTGCCTGGAGGGCTGATGG + Intronic
1147366750 17:39964142-39964164 CCAGCTGCCTGGAGGACTGAGGG + Intronic
1148957470 17:51365610-51365632 CCATCTGCAAGATGGACAGAGGG - Intergenic
1149562525 17:57619029-57619051 CCCTCTGCATGCTGGGAAGAAGG + Intronic
1150466257 17:65395306-65395328 CCATCTGCCTGGACTGCAGAAGG + Intergenic
1151503095 17:74505057-74505079 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
1152051395 17:77981325-77981347 CAATCTCCAGGGAGGGTAGAGGG - Intergenic
1152094160 17:78263488-78263510 CCCTCGGCAGGGAGGACAGAGGG + Intergenic
1152330376 17:79669261-79669283 CAACCTGCCTGGAGGGCAGGTGG - Intergenic
1152559172 17:81069376-81069398 CCATCTCCATGGAGTGCTGGAGG + Intronic
1152908240 17:82982080-82982102 CCATCACCATGGAGGTGAGAAGG - Intronic
1153716734 18:7857603-7857625 CCATTTGCAGGAAGGGCAAATGG - Intronic
1157076885 18:44476280-44476302 ACATCTACCTGGAGGACAGAGGG - Intergenic
1157105703 18:44772366-44772388 ACATCTGCCTGGAGAGCACAGGG + Intronic
1157405092 18:47416057-47416079 GCATCAGCATGGTGGGCGGATGG + Intergenic
1157915998 18:51664402-51664424 CCATCAGCATGCCAGGCAGAGGG - Intergenic
1158144083 18:54290823-54290845 CTATCTGGATGGAGGGCTGAGGG + Intronic
1160342549 18:78102050-78102072 CCATTTTCAAGGAGGTCAGAGGG + Intergenic
1160701004 19:507415-507437 CCATCTTGATTAAGGGCAGAGGG - Exonic
1162183861 19:8889396-8889418 ACATCTCCAGGGAGTGCAGAAGG + Intronic
1162736094 19:12747954-12747976 CCATCTGCAGCCAGGGCAGAGGG - Exonic
1162775037 19:12974452-12974474 CCAGTTGCAGGGAGGGTAGATGG + Exonic
1163384473 19:16991017-16991039 CCATCTCCAGGGAAGGGAGAGGG + Intronic
1163406293 19:17125184-17125206 CCAGCTACTTGGAGGGCTGAGGG + Intronic
1164673165 19:30084639-30084661 ACATCTGAATCCAGGGCAGAGGG - Intergenic
1165304959 19:34998109-34998131 CCAACTGCATGGCAGGCAGAAGG + Intronic
1165361851 19:35341683-35341705 GCATCTGCATGGCGGGCAGGGGG - Exonic
1166412023 19:42561724-42561746 CCCTCTGCAGGGAGGGCTGAGGG + Intergenic
1168148828 19:54434227-54434249 GCTGCTGCATGGAGGACAGACGG - Intronic
1168259646 19:55186225-55186247 CCAACTGCATGGAGGCCGGCCGG - Exonic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927431496 2:23030117-23030139 GCATCCACATGGAAGGCAGAAGG + Intergenic
928122496 2:28593095-28593117 GCATCTGCATGGAAAGCAGCAGG + Intronic
928317501 2:30257480-30257502 CCACCACTATGGAGGGCAGACGG - Exonic
929160067 2:38822838-38822860 ACATCTGCATGGGAGGGAGAAGG - Intronic
929172357 2:38944704-38944726 CCATCTGCATGGAGTCCCCATGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929564979 2:42978600-42978622 CCAGCTGGATGGAGGGCACATGG + Intergenic
930114854 2:47709712-47709734 CCATCTGCAAGGCAGGAAGACGG + Intronic
930977743 2:57484592-57484614 CCATATCCATGGAAGGCAGAAGG + Intergenic
931589400 2:63865315-63865337 CCAGCTGCCTAGAGGGCTGAAGG + Intronic
932685176 2:73863130-73863152 CCAAAAGCATGGAGGGCATAAGG - Exonic
933776883 2:85776488-85776510 CCATCAGGAAGGTGGGCAGAGGG + Intronic
934949745 2:98567991-98568013 CCACCTGCAAGGAAGGCACAAGG - Intronic
935827724 2:106968329-106968351 CCACCTCCAAGGAGGGGAGATGG + Intergenic
935934908 2:108171154-108171176 GCATCTGCCTGGAGGGCAGGGGG + Intergenic
937476069 2:122216575-122216597 CCATCTGCATGCCAGGAAGAGGG - Intergenic
938406474 2:131035744-131035766 CCACGTGCAAGGGGGGCAGAGGG - Intronic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
938702092 2:133888552-133888574 TGAAGTGCATGGAGGGCAGAGGG + Intergenic
939906753 2:147925740-147925762 CCATCTGCACAGAGGACATAAGG - Intronic
941378916 2:164766754-164766776 CCATGTGCATGGAGGAAAGCAGG - Intronic
943416580 2:187613779-187613801 CCATATGCATAGTGGGCATACGG + Intergenic
943445051 2:187974389-187974411 GCATTTGCATGGAAGGCAAATGG - Intergenic
944079403 2:195770140-195770162 CCCTCTGCATTGGAGGCAGAGGG - Intronic
944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG + Intronic
944812031 2:203336716-203336738 CCATTTACATGGAGGGCAGAAGG - Intronic
946063405 2:216965696-216965718 CCAGCTGCAAGAAGGGCACAAGG - Intergenic
946443695 2:219719499-219719521 AAATCTGCAATGAGGGCAGATGG + Intergenic
947231196 2:227888417-227888439 CCTTCTTCATCGAGGTCAGATGG - Intronic
947723059 2:232380821-232380843 CCACCTGCAGGAAGGCCAGAGGG - Exonic
947727409 2:232408902-232408924 CCACCTGCAGGAAGGCCAGAGGG - Exonic
947971286 2:234327548-234327570 CCATGAGCATGAAGGGCAGGGGG + Intergenic
948006058 2:234608450-234608472 CCATCTGCATGCAAAGCAGGTGG + Intergenic
948776752 2:240293199-240293221 CAGTCTGCCGGGAGGGCAGAAGG - Intergenic
948958677 2:241315388-241315410 CCATCTTCTTGGAGGACAGGAGG + Intronic
1169194589 20:3676320-3676342 CCATCTACAGGGAGGGGAGCAGG - Intronic
1170351669 20:15448095-15448117 CCTTCTGCTTGGAAGGTAGAAGG + Intronic
1170680084 20:18518615-18518637 CCATCTGCCTTGAGTGGAGAGGG + Intronic
1170931255 20:20771224-20771246 CCATCTGCAATGAGGACAGTGGG - Intergenic
1171096968 20:22341568-22341590 GCATCTGCATCGAGTGCCGAGGG + Intergenic
1171471964 20:25379360-25379382 CCATCTGCTAGGAGGGCAGAGGG - Intronic
1172098017 20:32470078-32470100 CCTTCTGCAGGGTGGGCAGTCGG - Intronic
1172130594 20:32652376-32652398 CCCTTTGCATGGAGGGCTGCTGG - Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1172782286 20:37443967-37443989 CCATCTGCCTGGGGTGGAGACGG + Intergenic
1173703921 20:45096364-45096386 CTCTCTGCATGGAGGGGACAGGG + Intronic
1174478611 20:50815153-50815175 CCAGCTGCATGGCTGGCAGAGGG + Intronic
1175517772 20:59579721-59579743 CCAGCTGCTTGGAGGACAGGAGG + Intronic
1175690427 20:61061712-61061734 CCATCTACTTGTAGGGCAGAGGG - Intergenic
1176302719 21:5106225-5106247 GCCTCTGCCTGGTGGGCAGAGGG - Intergenic
1177958885 21:27636939-27636961 GCTTCTGCTTGGAGGGCTGAGGG - Intergenic
1178399519 21:32273322-32273344 CTACCTCCATCGAGGGCAGAGGG - Intronic
1179175756 21:39006759-39006781 TCATCTTGCTGGAGGGCAGAAGG - Intergenic
1179519374 21:41932075-41932097 CCACCTCCAGGGAGGGCAGAGGG + Intronic
1179726195 21:43342861-43342883 CCAACTGAGTGCAGGGCAGAGGG - Intergenic
1179832550 21:44006459-44006481 CCCTCTGCACAGAGGGCAAAAGG - Intergenic
1179854305 21:44155698-44155720 GCCTCTGCCTGGTGGGCAGAGGG + Intergenic
1182549910 22:31095284-31095306 CCATCTGCAGGGTGGGGAGAGGG - Exonic
1184325004 22:43776197-43776219 CCACCTGCATGGAGGCCACAGGG + Intronic
1185002367 22:48253693-48253715 CCAACTCCAGGGAGGGAAGAGGG + Intergenic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
950413066 3:12851461-12851483 CCATCTGTGTGGGGTGCAGAAGG - Intronic
950638030 3:14329928-14329950 CCAGCTGCTTGGAAGGCTGACGG - Intergenic
950967936 3:17159300-17159322 CCATTTTCTTGGAGGGCAGGTGG + Intronic
952133344 3:30389590-30389612 ACATCTGCCTGAAGGGGAGAAGG - Intergenic
953699468 3:45184634-45184656 TCATCTTCCTGGAAGGCAGAGGG - Intergenic
954532177 3:51330502-51330524 GCATCTGGATGGGGGGCAGACGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958611477 3:96432031-96432053 CAATCTCCAGGGAGGGGAGAGGG + Intergenic
958708264 3:97684627-97684649 GATTCAGCATGGAGGGCAGATGG - Intronic
959783644 3:110267152-110267174 GAATCTGCATGGAGGGAAGGAGG - Intergenic
960415631 3:117381909-117381931 CTAGCTGCATGGAGGGTAGGGGG + Intergenic
961131970 3:124477176-124477198 CCTTCAGCATGGTGGACAGAAGG + Intronic
961716474 3:128861098-128861120 CCATCTGCGTGGGGTGCAGGAGG + Intergenic
961805225 3:129484283-129484305 CCATCTGCCTGGGGTGCAGAAGG - Intronic
962403532 3:135081306-135081328 CCATATGTATGGAGGGTGGAGGG + Intronic
962923372 3:139970708-139970730 CCATCTCAATGGATGGCAGGAGG - Intronic
962934636 3:140068453-140068475 CCATTTGCATGGAAAGAAGAAGG - Intronic
964443148 3:156732735-156732757 CCAGCTGAATCAAGGGCAGAGGG + Intergenic
965708151 3:171530393-171530415 CCATCTGCAAGCAGGGAAGCTGG + Intergenic
966902956 3:184500235-184500257 ACTTCTCCCTGGAGGGCAGAGGG + Intronic
966922847 3:184625489-184625511 ACATCTGCATTCAGGGCAGGAGG - Intronic
968020057 3:195377922-195377944 CCGTCTGCCTGGAGGTCTGAAGG - Intronic
968509807 4:990706-990728 ACATCTGCATGGGGGGCAGTGGG - Intronic
968590934 4:1459310-1459332 CCACCTGCATCCATGGCAGAAGG - Intergenic
969721935 4:8896865-8896887 CCTTGGGCATGCAGGGCAGAAGG + Intergenic
970158960 4:13170199-13170221 GCATCTTCATGGAAGGTAGAAGG + Intergenic
970691489 4:18625454-18625476 GCATATGCATGTAGGGCAGATGG + Intergenic
971328494 4:25663555-25663577 CCAAATGTATGTAGGGCAGAAGG + Intronic
972747895 4:41958123-41958145 CCAGCTACTTGGAGGGCTGAAGG - Exonic
973727382 4:53789876-53789898 CCATATGCACGGAGGGCTGCCGG - Intronic
973788476 4:54357234-54357256 CCATTTGGATAAAGGGCAGAGGG + Intergenic
975199165 4:71565322-71565344 ACATCTTCATGGGAGGCAGAGGG + Intronic
976679153 4:87735548-87735570 CAAGCTACATGGAGGGAAGAGGG - Intergenic
979776419 4:124593751-124593773 CCTGCTGCATGGAGAGCAGCAGG - Intergenic
981334108 4:143549372-143549394 CCATCTGCACGGACGGCTGCTGG - Intronic
981670949 4:147286581-147286603 GCATCTGCATGGAGACCAAAGGG + Intergenic
983695388 4:170522485-170522507 CCATCAGCAAGGAAGGCTGATGG - Intergenic
985139297 4:186822277-186822299 CAATCTCCAGGGAGGGGAGAGGG - Intergenic
985643333 5:1073855-1073877 CCATCAACAGGCAGGGCAGATGG + Intronic
985936738 5:3103166-3103188 CCATCTGCAGGGTGGGAAGTGGG + Intergenic
986199635 5:5569510-5569532 CCCCCAGCCTGGAGGGCAGATGG + Intergenic
986264452 5:6180656-6180678 CCATCAGGATGGAGGGGAGGAGG - Intergenic
986264598 5:6181209-6181231 CCCTCAGGATGGAGGGGAGAAGG - Intergenic
987718976 5:21610502-21610524 CCATCTGAAGAGAGGCCAGATGG - Intergenic
990505709 5:56442639-56442661 CCATCTGCAAGTAAGGAAGACGG - Intergenic
990660291 5:58006632-58006654 ACATCTACATGGATGGCAGCAGG - Intergenic
992070437 5:73143913-73143935 CCGTCTGCATGTAAGGCAGCTGG - Intergenic
992130967 5:73692694-73692716 CCTTCTGCAGGGAGGGCCGGAGG + Intronic
994183289 5:96791118-96791140 CCTTGAGCATGGAGGGCTGATGG + Intronic
998353620 5:141516663-141516685 TCAGCTGCCTGGAGGCCAGAAGG - Exonic
1000967581 5:167677033-167677055 TAGTCTGCATGGAGCGCAGAGGG - Intronic
1001218706 5:169880309-169880331 CCATATGCCTGGAAGGCAGAAGG - Intronic
1001343022 5:170864440-170864462 CCTAATGCTTGGAGGGCAGAGGG + Intronic
1001871757 5:175162308-175162330 GCACCTGCAAGGAGGGCTGAGGG - Intergenic
1003112564 6:3261795-3261817 CTACCTGCATGGACGGTAGATGG - Intronic
1003920129 6:10825123-10825145 CCATGTTCAAGGAGGGAAGAGGG - Intronic
1004524299 6:16391855-16391877 CCAGCAGCCTGGAGGGGAGAAGG + Intronic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006480057 6:34285131-34285153 CCCTCTCCATGCAGGGCAGATGG + Exonic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1006830746 6:36966755-36966777 CGAACTGCTAGGAGGGCAGATGG + Intergenic
1007203567 6:40131333-40131355 CCCTCTGCAGGAAGGGCAGTGGG - Intergenic
1008429472 6:51398684-51398706 ACACCTGCATGGAGGACAGAAGG + Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1011310391 6:85974269-85974291 CCATCTGAAAGGAGAGCATAGGG + Intergenic
1011535333 6:88370444-88370466 CCATGTGCTTGGTGGCCAGAAGG - Intergenic
1012433840 6:99193700-99193722 CCAGCTTCATGTAGGGCAGATGG + Intergenic
1013233879 6:108179890-108179912 CCATCTTCCTGGAGGGTTGAGGG - Intronic
1013281930 6:108646125-108646147 CCATCCGAATGGAGGCCAAAAGG + Intronic
1016319158 6:142823128-142823150 CCATCTGCAGAGGCGGCAGAGGG - Intronic
1018219489 6:161564222-161564244 CCATCTGCCTAGAGGCCAGTAGG + Intronic
1018360859 6:163066354-163066376 CCTTCTGGATGAAGGACAGAGGG - Intronic
1018859307 6:167699183-167699205 CCAGCTGCAGGGAGGCCAGCTGG + Intergenic
1018880053 6:167868875-167868897 CCAGCTGCTTGGAGGGCTGAGGG - Intronic
1019608747 7:1924389-1924411 TCATCTGCACGGAGGGGAAAGGG + Intronic
1019685483 7:2379697-2379719 CCATCTGCAATGTGGTCAGAGGG - Intronic
1020093570 7:5355116-5355138 CTAGCTGCAGGGAGGCCAGAAGG - Intronic
1020262001 7:6536065-6536087 CCATCTGGAGAGAGGTCAGAGGG - Intronic
1020794547 7:12664157-12664179 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
1020807895 7:12813311-12813333 TTATCTGCATGGAGTCCAGATGG + Intergenic
1023611758 7:41978712-41978734 CCATATTCATGGAGAGAAGAAGG - Exonic
1024036679 7:45512718-45512740 CCATCTCCAGGGAGGGGAGGGGG - Intergenic
1025639271 7:63352041-63352063 CCAACTGCATTGTGGTCAGATGG - Intergenic
1025643428 7:63396051-63396073 CCAACTGCATTGTGGTCAGATGG + Intergenic
1026830395 7:73606917-73606939 CCATCTACTTGGGGGGCAAAGGG + Intronic
1027473838 7:78605682-78605704 GAATCTGGAAGGAGGGCAGAAGG + Intronic
1027855227 7:83502502-83502524 CCAACAGCATGGAGGTCAGAAGG - Intronic
1029226731 7:99034037-99034059 CCATCTTTATGTTGGGCAGAGGG + Intronic
1029226911 7:99035001-99035023 CCATCTGCCTGTAGGGCAGGCGG - Intronic
1029571227 7:101370967-101370989 CCATCTGCAAGGAGGGAAACTGG - Intronic
1031028509 7:116709051-116709073 TCATGTGCATGGAGGGCCAAAGG + Intronic
1032461867 7:132117843-132117865 GCTTCTACATGGAGGGCAGGGGG + Intergenic
1032995077 7:137435892-137435914 CCAGCTGCTTGGAAGGCTGAGGG - Intronic
1033625877 7:143109150-143109172 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
1034684882 7:152961510-152961532 CCAGCTGCACGAAGGACAGAAGG + Intergenic
1034959138 7:155353569-155353591 CCAGCTGCTTGTAGGGGAGATGG + Intergenic
1035485042 7:159216553-159216575 GCTTCTGCATGGTTGGCAGAGGG + Intergenic
1038347512 8:26745825-26745847 CCATCCACATGAAGGGCAGGGGG - Intergenic
1039004925 8:33025028-33025050 TCATCAGCATGGAGGCCAAAAGG - Intergenic
1039998332 8:42554941-42554963 CCAGCTGCGTGAAGGGGAGAAGG + Intergenic
1040414761 8:47186445-47186467 CAACCTCCATGGAGGGAAGAGGG + Intergenic
1045097052 8:98808912-98808934 CCACCTCCAGGGAGGGGAGAAGG + Intronic
1046319757 8:112557519-112557541 ACATCTCCGTGGAGGGGAGAAGG + Intronic
1047204293 8:122791041-122791063 ACAGGTGCATGGAGGGCAGGAGG - Intronic
1049349595 8:142157462-142157484 CCAGCTGGAAGGAGGGCAGGTGG - Intergenic
1049392727 8:142380443-142380465 TGAACTGCATGGAGGGCAGAGGG + Intronic
1049592282 8:143468133-143468155 CCATCTGCCCGGAGGCCAGGTGG + Intronic
1049908019 9:236973-236995 CAATCTGCAAGGAGGGCTGGGGG + Intronic
1049935686 9:499545-499567 CCCTCTGCAAGGATGGCAGTTGG - Intronic
1051380671 9:16455245-16455267 GCATCTGCAGGTGGGGCAGAGGG + Intronic
1055404556 9:75961032-75961054 ACATCTGCCTGGAAGGAAGATGG + Intronic
1055695591 9:78880586-78880608 CCGTCTGCATAGAGTGCTGAGGG - Intergenic
1056412648 9:86346582-86346604 ACATCTGCATGCAGAGCAGAAGG + Intronic
1056640046 9:88362282-88362304 CCAGCTGCTTGGAAGGCTGAGGG + Intergenic
1057660450 9:96996851-96996873 CCAGCTGCTTGGGAGGCAGAAGG - Intronic
1057762468 9:97887962-97887984 CCACCTGAATGAAGGACAGAAGG + Intergenic
1059408178 9:114115294-114115316 CCAGCTGGTTGGAGGGCAGGGGG + Intergenic
1060214637 9:121731447-121731469 CCTACTTCAAGGAGGGCAGAGGG - Intronic
1060969958 9:127732275-127732297 CCATCTGCAGGAAGGGTAGGTGG + Exonic
1187103448 X:16218201-16218223 CCATCTGCCTTGAGTGGAGAGGG + Intergenic
1187632946 X:21195193-21195215 CCCTCTGAAAGGAGTGCAGAGGG - Intergenic
1191013880 X:55789712-55789734 CCATCTGCCTTGAGTGGAGAGGG + Intergenic
1193470883 X:81901808-81901830 GCATCTAGATGGAGGGGAGAAGG - Intergenic
1197219785 X:123900946-123900968 CCATCTGCAAGGTAGGAAGAGGG - Intronic
1197918387 X:131561006-131561028 CCCTTTGCATGGAGGGAAGGTGG - Intergenic
1198842741 X:140876468-140876490 TCATCTCCAGGGAGGGGAGAGGG + Intergenic
1200166136 X:154036534-154036556 CCAGCTACATGGAAGGCTGAGGG + Intronic
1201763635 Y:17561697-17561719 CCATCCCCATGCAGGGCAAAGGG + Intergenic
1201837918 Y:18344293-18344315 CCATCCCCATGCAGGGCAAAGGG - Intergenic
1202027563 Y:20540738-20540760 CCAACTGCAGGAAGGGCAGAAGG + Intergenic