ID: 1068933968

View in Genome Browser
Species Human (GRCh38)
Location 10:62618295-62618317
Sequence GTTCCAAATGGACCCCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068933968 Original CRISPR GTTCCAAATGGACCCCAATC AGG (reversed) Intronic
901628656 1:10637747-10637769 TTTGCAAAGGGAACCCAATCTGG + Exonic
902664824 1:17930247-17930269 GTTCAAAATCCACCCCAATTTGG + Intergenic
906078271 1:43067922-43067944 GATCCAAATGGACCCGGTTCGGG - Intergenic
917212053 1:172641431-172641453 ATTCCAACTGGACCTTAATCTGG - Intergenic
922860034 1:228808587-228808609 GTTCCTACTAGAGCCCAATCAGG - Intergenic
1068933968 10:62618295-62618317 GTTCCAAATGGACCCCAATCAGG - Intronic
1070610406 10:77928356-77928378 CCTCCAGATGGACCCCAATATGG + Intergenic
1072751949 10:97987320-97987342 ATTCCACATGAACCCCAGTCGGG - Intronic
1073232907 10:101987537-101987559 CTGCAAGATGGACCCCAATCTGG + Intronic
1074700125 10:116085422-116085444 GTTACCAATGGATCCCAAGCTGG + Intronic
1075977912 10:126712814-126712836 GTTCCTAATGGGCCACAAACTGG - Intergenic
1088144057 11:106652945-106652967 GTTCCAAACTGACCCCAACTAGG + Intergenic
1104479240 12:129093066-129093088 GTTCCAAATGGATGCCATGCAGG + Intronic
1110133248 13:72033497-72033519 TTTTCAAATTGACCACAATCTGG - Intergenic
1115895123 14:38077823-38077845 TTTCCAAATAGATCCCACTCTGG - Intergenic
1118652092 14:67907568-67907590 GTTCCAGCTGGACCCCCAGCAGG - Intronic
1121148933 14:91612449-91612471 TTTCAAAATGTACACCAATCAGG - Intronic
1126752568 15:51892197-51892219 GTTCAAAATGGACTACTATCTGG - Intronic
1128234606 15:66059114-66059136 TTTCTAAATGGAGCCAAATCTGG - Intronic
1128904601 15:71455680-71455702 GTTCCAGATGAACCCCAATTTGG + Intronic
1131970439 15:97887196-97887218 ATTCCAAATGGACCATCATCTGG - Intergenic
1133401974 16:5494730-5494752 ATTCCAAATGGACCACCATCTGG - Intergenic
1149370777 17:55991793-55991815 GTGCCACAGGGACCCCAATTTGG - Intergenic
1152325104 17:79631521-79631543 GTCCCTCATGGACCCCAGTCTGG - Intergenic
1161026934 19:2041272-2041294 GCTCCAACCGGACCCCAACCAGG + Intronic
1162319113 19:9960354-9960376 GCACCAAATGCACCCCATTCTGG + Exonic
1167218093 19:48178402-48178424 TTTCCAAATGGCCCCCCAACTGG - Intronic
1167263290 19:48470648-48470670 GTTCAACATGGACCCCAAGAAGG + Exonic
927926484 2:27017230-27017252 GAGCCAAATGGACCCCCATTAGG + Intronic
933615134 2:84475942-84475964 TTTTCTAATCGACCCCAATCAGG + Intergenic
937655755 2:124373338-124373360 ATTCAAAATTGACCACAATCAGG + Intronic
939557481 2:143693327-143693349 GTTTCAAATGGATCACAAACGGG - Intronic
1169280452 20:4262727-4262749 GTTCCAAAAAGTTCCCAATCTGG + Intergenic
1170014845 20:11768960-11768982 GTTCCAAATAGAGCCAAATAGGG - Intergenic
1171213575 20:23335526-23335548 GTTCCTAATGGCCCCCAAACTGG + Intergenic
1179644483 21:42767180-42767202 ATTCAAAATGGGCCCCAATAGGG + Intronic
1180917697 22:19500221-19500243 GTTCCAAAGGGCCACCAACCAGG - Intronic
953590576 3:44248876-44248898 CTTCCAAATTCTCCCCAATCTGG - Intronic
953932364 3:47011969-47011991 GGTGCAAATGGACCCCAAAAAGG + Intergenic
961009632 3:123427042-123427064 GTCCCTAATGTCCCCCAATCAGG - Intronic
962262399 3:133921179-133921201 GTTCATAATGGCCCCCAAACTGG + Intergenic
964647666 3:158975278-158975300 TTTCCAAATGGATTCCAACCTGG - Intronic
973015413 4:45131206-45131228 GTTCCATAGAGACCACAATCTGG + Intergenic
973294170 4:48497204-48497226 GCTCCAAATGGAACTAAATCAGG + Intergenic
980116476 4:128684502-128684524 GGCGCAAATGCACCCCAATCTGG - Intergenic
980219847 4:129900965-129900987 GCTCCAAATGTTCCCAAATCAGG + Intergenic
989308273 5:39982104-39982126 GATCCAAACGCCCCCCAATCAGG - Intergenic
993517893 5:88860562-88860584 GTGCCAAATGCAGCCCAATGGGG + Intronic
996036949 5:118769062-118769084 GTTCCAAATTGAATCAAATCTGG + Intergenic
999619919 5:153462444-153462466 GTACCAAAGGGAACCTAATCTGG - Intergenic
1007197673 6:40076676-40076698 GTTCCAAGTGGTCCCCAAAAGGG + Intergenic
1007344330 6:41216875-41216897 GTTCCATATGGACTCCCCTCTGG + Intergenic
1010685952 6:78855614-78855636 TTTTCTAATCGACCCCAATCAGG - Intergenic
1011383289 6:86766275-86766297 GCTCCAGATGGGCCCCTATCAGG + Intergenic
1011973366 6:93258114-93258136 CTTCCAAATGGACAACATTCGGG + Exonic
1012455096 6:99394647-99394669 GTTCGAAGTTGACCTCAATCAGG + Intergenic
1015760917 6:136659404-136659426 GTTACAAATGCACCCCACACAGG + Intronic
1016304240 6:142666594-142666616 CTTTAACATGGACCCCAATCAGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1024009919 7:45258861-45258883 GTTCCAAATGCACCTCTATGTGG - Intergenic
1024301439 7:47890273-47890295 GTTCCAAGTGGAACCTCATCGGG - Intronic
1034498781 7:151437083-151437105 TTTCCAAATGGACCACAGCCTGG + Intronic
1035980873 8:4370317-4370339 CTTACAAAGGGACCCCCATCAGG - Intronic
1039096771 8:33895377-33895399 CTTCCAAATGAGACCCAATCTGG + Intergenic
1040712997 8:50212273-50212295 GGTTAAAATGGACCCCTATCTGG - Intronic
1043034708 8:75181681-75181703 CTTACAAAGGGAACCCAATCAGG + Intergenic
1047246872 8:123153922-123153944 TTTCCAAATGTAGCCCAATGTGG - Intergenic
1055880749 9:81000535-81000557 GTTCCAAATCATCCCCAAACAGG - Intergenic
1058284532 9:103159908-103159930 CTTACAAAGGGACTCCAATCAGG - Intergenic
1061064929 9:128271678-128271700 GTTCCAAATGGACTCCAGGCTGG - Intronic
1187825347 X:23330244-23330266 CTTCCTAATGGCACCCAATCTGG - Intergenic
1193776098 X:85643625-85643647 CATACAAATGTACCCCAATCAGG + Intergenic
1201527463 Y:14952710-14952732 GGTGCAACTGCACCCCAATCTGG + Intergenic