ID: 1068934466

View in Genome Browser
Species Human (GRCh38)
Location 10:62622399-62622421
Sequence AGGGAAAAGGAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2563
Summary {0: 1, 1: 4, 2: 29, 3: 336, 4: 2193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068934466_1068934472 -3 Left 1068934466 10:62622399-62622421 CCATCCTGCTTCTCCTTTTCCCT 0: 1
1: 4
2: 29
3: 336
4: 2193
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934466_1068934477 21 Left 1068934466 10:62622399-62622421 CCATCCTGCTTCTCCTTTTCCCT 0: 1
1: 4
2: 29
3: 336
4: 2193
Right 1068934477 10:62622443-62622465 TTTCTGCTGTTGTTAATGTTGGG No data
1068934466_1068934476 20 Left 1068934466 10:62622399-62622421 CCATCCTGCTTCTCCTTTTCCCT 0: 1
1: 4
2: 29
3: 336
4: 2193
Right 1068934476 10:62622442-62622464 CTTTCTGCTGTTGTTAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068934466 Original CRISPR AGGGAAAAGGAGAAGCAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr