ID: 1068934472

View in Genome Browser
Species Human (GRCh38)
Location 10:62622419-62622441
Sequence CCTTCCAGCCAGGAGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068934463_1068934472 9 Left 1068934463 10:62622387-62622409 CCTAAACTCCCACCATCCTGCTT 0: 1
1: 0
2: 0
3: 25
4: 275
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934465_1068934472 0 Left 1068934465 10:62622396-62622418 CCACCATCCTGCTTCTCCTTTTC 0: 1
1: 0
2: 14
3: 112
4: 984
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934461_1068934472 11 Left 1068934461 10:62622385-62622407 CCCCTAAACTCCCACCATCCTGC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934462_1068934472 10 Left 1068934462 10:62622386-62622408 CCCTAAACTCCCACCATCCTGCT 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934466_1068934472 -3 Left 1068934466 10:62622399-62622421 CCATCCTGCTTCTCCTTTTCCCT 0: 1
1: 4
2: 29
3: 336
4: 2193
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934459_1068934472 29 Left 1068934459 10:62622367-62622389 CCAGAATCCAGAGAGCGGCCCCT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934464_1068934472 1 Left 1068934464 10:62622395-62622417 CCCACCATCCTGCTTCTCCTTTT No data
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934460_1068934472 22 Left 1068934460 10:62622374-62622396 CCAGAGAGCGGCCCCTAAACTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data
1068934467_1068934472 -7 Left 1068934467 10:62622403-62622425 CCTGCTTCTCCTTTTCCCTTCCA 0: 1
1: 2
2: 16
3: 129
4: 1243
Right 1068934472 10:62622419-62622441 CCTTCCAGCCAGGAGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068934472 Original CRISPR CCTTCCAGCCAGGAGTCCTG TGG Intronic
No off target data available for this crispr