ID: 1068934571

View in Genome Browser
Species Human (GRCh38)
Location 10:62623120-62623142
Sequence CTTTCAACCCCGAAAGATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068934571_1068934573 21 Left 1068934571 10:62623120-62623142 CCACCATCTTTCGGGGTTGAAAG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1068934573 10:62623164-62623186 TGCAAGCCCCACCTGTGCCCTGG 0: 1
1: 0
2: 1
3: 40
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068934571 Original CRISPR CTTTCAACCCCGAAAGATGG TGG (reversed) Exonic
900880000 1:5373994-5374016 GTTTCAACCCCCAAACAAGGAGG + Intergenic
920584433 1:207144024-207144046 CTGTCGACCCCTAAAAATGGTGG + Intronic
924016276 1:239727660-239727682 CTTTCAGCACCGAATGATGCAGG + Intronic
924714860 1:246563945-246563967 CTTTCAAACCCTAAATATAGAGG + Intronic
1064571114 10:16694111-16694133 CTTTCAACCTTGACACATGGAGG + Intronic
1064683841 10:17838365-17838387 GTTTCTACCCCGAAAAATGTTGG + Intronic
1068155323 10:53189711-53189733 CTTTAAAACCCGAAAAATGTAGG - Intergenic
1068416210 10:56726306-56726328 TTTTCAACCGCTAAAGATGGAGG + Intergenic
1068934571 10:62623120-62623142 CTTTCAACCCCGAAAGATGGTGG - Exonic
1073658403 10:105444054-105444076 CTTTTTACCCCCAAAGATTGTGG - Intergenic
1077319248 11:1933783-1933805 CTTTGAAGCCCGGAAGAAGGAGG + Exonic
1078953964 11:16168570-16168592 CTTTCTACCCAGAAATATAGTGG - Intronic
1079051157 11:17160941-17160963 CTTTCAAACCAGAAAGATGAGGG + Intronic
1081826076 11:46053415-46053437 CTTTCAACCTCCAAAGTTGCTGG + Intronic
1087143565 11:94790058-94790080 CTTTCAGCTCCGTAAGATGAGGG - Intronic
1120759579 14:88273619-88273641 CTCTAAATCCCAAAAGATGGTGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1135418964 16:22291548-22291570 CTCTCCACCCCGAAAAATGTTGG + Intergenic
1140182986 16:72738913-72738935 CACTTAACCCCGAAAGGTGGAGG - Intergenic
1142419516 16:89961849-89961871 CTTTGAGCCTCGAAAGGTGGGGG + Exonic
1151000593 17:70370819-70370841 GTTTCAATCCAGAAAGAAGGAGG + Intergenic
1153412592 18:4810408-4810430 CTTTCACCTCCTAAAGATGGAGG + Intergenic
1157520042 18:48339204-48339226 TTTTCACCCCCAAGAGATGGGGG - Intronic
1158186384 18:54776443-54776465 CATTCAACCACAAGAGATGGAGG - Intronic
1163997976 19:21070079-21070101 ATTTGAACCCCGGGAGATGGAGG + Intergenic
1164682900 19:30147748-30147770 CTCTCAACCCCAGGAGATGGAGG - Intergenic
1165779958 19:38426374-38426396 GTCTCGACACCGAAAGATGGGGG - Intergenic
1167647701 19:50714610-50714632 CTTTGAACCCTGAAAGGTTGAGG + Intronic
928430570 2:31215084-31215106 CTTTCAACCCCAAGAGGTAGCGG + Intronic
937674411 2:124573766-124573788 CTTTGAATCCAGACAGATGGAGG + Intronic
937984382 2:127632050-127632072 CTTTCACACCCTCAAGATGGGGG - Intronic
938738022 2:134204185-134204207 CTGTCAAACCCTACAGATGGTGG - Intronic
940550176 2:155144208-155144230 CTTTTTACACAGAAAGATGGAGG + Intergenic
948147052 2:235715853-235715875 CTCTCAAGCCAGAAAGCTGGAGG - Intronic
1184377952 22:44126478-44126500 CTTTCAACTCAGAAGGCTGGAGG + Intronic
951666926 3:25136735-25136757 ATTTCAACACCAAAGGATGGGGG + Intergenic
956529158 3:70198624-70198646 CTTTCTTCCCAGAAAGATGGTGG + Intergenic
959491955 3:107001039-107001061 CTTTAAAACCTGAAGGATGGAGG + Intergenic
961659252 3:128459686-128459708 CTTTCAAGCCCTAAAGATCTTGG + Intergenic
962351696 3:134661045-134661067 CTCTCAAACCATAAAGATGGGGG - Intronic
965007777 3:163047237-163047259 CTCTCTACCCCGAAAGATGAAGG - Intergenic
969878668 4:10155408-10155430 CTTTCAACCCCAGCAGATGAAGG - Intergenic
970269483 4:14329148-14329170 CATTAAACCCACAAAGATGGTGG - Intergenic
972550302 4:40126839-40126861 CGTTTGAACCCGAAAGATGGAGG - Intronic
978105753 4:104900076-104900098 CTTTCAACCGCAAAAGAGGCAGG + Intergenic
986403331 5:7400579-7400601 CCTTCAACCCCCAAGGAAGGAGG - Intronic
986903537 5:12467140-12467162 CTTTCAGTCCCTAAAGAAGGTGG + Intergenic
987628232 5:20431408-20431430 GTTTGAACCCAGAAAGGTGGAGG + Intronic
988237786 5:28568575-28568597 CTCTCAAACCCAAAAGGTGGAGG + Intergenic
989659585 5:43785985-43786007 TTTTCAACCCCAGGAGATGGGGG + Intergenic
992229289 5:74647987-74648009 CTTTCAACTCTGAAAGACAGAGG + Intronic
992333913 5:75745760-75745782 ATTTAAACTCAGAAAGATGGAGG + Intergenic
999574925 5:152965441-152965463 CATTCAACCCAGAAACCTGGCGG + Intergenic
1004118784 6:12798239-12798261 CTTTCAATCCAGAAATCTGGAGG + Intronic
1006518607 6:34558488-34558510 CATTCCACCCAGCAAGATGGAGG - Intergenic
1014005049 6:116408374-116408396 CTTGGAACCCCGAAAAATGCTGG - Intronic
1015572839 6:134639515-134639537 CTTTCAACCCAGATACAAGGAGG - Intergenic
1019347628 7:538561-538583 CTGTCACCCCAGAAAGGTGGGGG + Intergenic
1023778681 7:43635375-43635397 CTTACAAGCCCCTAAGATGGGGG - Intronic
1029503434 7:100948116-100948138 GTTTCAACCCAGAAAGAAGATGG - Intergenic
1031831696 7:126635015-126635037 CTTTCACCCCCGTAAGAGGAGGG - Intronic
1041043639 8:53871212-53871234 CTTTCAACCTAGAAACTTGGAGG + Intronic
1042820798 8:72927850-72927872 CTTTGAAGCCCAAAAGATGATGG - Intronic
1051818194 9:21134114-21134136 CTTGGAACCATGAAAGATGGAGG - Intergenic
1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG + Intronic
1061758703 9:132834667-132834689 CTTACAACGCCGAAATATGCAGG + Intronic
1185977452 X:4737541-4737563 GTTTGAACCCCGGGAGATGGAGG + Intergenic
1186280842 X:7991217-7991239 ATTGCAATCCCGAAAAATGGAGG - Intergenic
1191667281 X:63716364-63716386 TTTTCTCCCCTGAAAGATGGAGG - Intronic
1194924861 X:99812195-99812217 ATATCAGCCCAGAAAGATGGAGG + Intergenic