ID: 1068938070

View in Genome Browser
Species Human (GRCh38)
Location 10:62655559-62655581
Sequence ACACTTGCAGAGTCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068938062_1068938070 30 Left 1068938062 10:62655506-62655528 CCTCATCAGCATCCCCCTGGCCA 0: 1
1: 0
2: 4
3: 42
4: 335
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118
1068938069_1068938070 -4 Left 1068938069 10:62655540-62655562 CCGTGACGTTGTGCTGAATACAC 0: 1
1: 0
2: 1
3: 4
4: 58
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118
1068938066_1068938070 16 Left 1068938066 10:62655520-62655542 CCCTGGCCAACTGGAAGCAACCG 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118
1068938064_1068938070 18 Left 1068938064 10:62655518-62655540 CCCCCTGGCCAACTGGAAGCAAC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118
1068938068_1068938070 10 Left 1068938068 10:62655526-62655548 CCAACTGGAAGCAACCGTGACGT 0: 1
1: 0
2: 1
3: 2
4: 38
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118
1068938067_1068938070 15 Left 1068938067 10:62655521-62655543 CCTGGCCAACTGGAAGCAACCGT 0: 1
1: 0
2: 0
3: 13
4: 343
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118
1068938065_1068938070 17 Left 1068938065 10:62655519-62655541 CCCCTGGCCAACTGGAAGCAACC 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068938070 Original CRISPR ACACTTGCAGAGTCGTGCTG TGG Intronic
908766293 1:67557835-67557857 ATACTTGAAGAGCTGTGCTGTGG + Intergenic
909266976 1:73572202-73572224 ACTTTTGAAGAGTCGTGGTGAGG - Intergenic
909340136 1:74522448-74522470 ACACTTCCAGAATGGTGCTTGGG + Intronic
910764644 1:90769404-90769426 ACACTTGCATAGTGTTCCTGGGG - Intergenic
913186759 1:116375455-116375477 ACACATGCACAGTAGTGATGCGG + Intronic
916079225 1:161222074-161222096 TCACCTGCAGAGTCGTGCCCAGG + Intergenic
916284532 1:163091280-163091302 ACAGTTTCACAGTAGTGCTGAGG + Intergenic
917611430 1:176692660-176692682 CCACTTGCAGAGTGGTGTTGGGG + Intronic
918047868 1:180952305-180952327 ACACTTGAAGTTTCTTGCTGTGG - Intergenic
921334579 1:214073556-214073578 TCATGTGCAGAGTCCTGCTGGGG + Intergenic
922450415 1:225732880-225732902 ACAGTTGCAGAGCAGGGCTGCGG + Intergenic
1063005188 10:1963706-1963728 ACGCGTGGAGAGCCGTGCTGCGG - Intergenic
1068938070 10:62655559-62655581 ACACTTGCAGAGTCGTGCTGTGG + Intronic
1070163407 10:73880009-73880031 ACACTTGCAGGGTGATGGTGAGG - Intergenic
1070366552 10:75742474-75742496 ACACTTGAATAGGTGTGCTGTGG + Intronic
1072466603 10:95669116-95669138 ACACTGGCAGAGTAGTGGGGGGG + Intronic
1076527743 10:131123092-131123114 TCACCTGCAGGGTCCTGCTGAGG + Intronic
1076853753 10:133105355-133105377 ACACTTGCAGAGCTGGGCCGGGG - Intronic
1076924178 10:133473490-133473512 AGACCTGCTGAGTCTTGCTGGGG + Intergenic
1077211970 11:1375327-1375349 ACCCTTGCTGGGTCGTGCTGAGG - Intergenic
1077633137 11:3824484-3824506 ACCCTGGCAGAGGGGTGCTGGGG + Intronic
1085911675 11:80834332-80834354 CTACTTGCAGAGTCACGCTGAGG - Intergenic
1091999740 12:5022428-5022450 ACATTTGGAGAGTCCTTCTGTGG + Intergenic
1096235605 12:49924059-49924081 ACACTTGCAATGTATTGCTGGGG + Intergenic
1097532980 12:60829130-60829152 ACACTTGCAGATTTGTTTTGAGG - Intergenic
1101593826 12:106145927-106145949 TCACGTGCAGGGACGTGCTGGGG + Intergenic
1104659877 12:130603601-130603623 ACACTTGCAGTCACGAGCTGAGG + Intronic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1114545173 14:23494647-23494669 ACACTTGCATACTTTTGCTGAGG - Intronic
1115404611 14:33000446-33000468 ATACATGCAGAGTCTTGCAGTGG - Intronic
1119138172 14:72239699-72239721 ACACTTTCAGAGGAGGGCTGAGG - Intronic
1120035384 14:79691132-79691154 AGACTTGGAGAGTGGTGCTGTGG - Intronic
1126461000 15:48914497-48914519 ACACTGGCAGAGAGGAGCTGTGG - Intronic
1129693808 15:77729219-77729241 GCACTTGCAGAGTTGGGCTAAGG + Intronic
1130095701 15:80854266-80854288 ACATTTGCAGAGCTGAGCTGTGG - Intronic
1130105973 15:80928754-80928776 ACATAAGCAGAGTCGTGCTCAGG - Intronic
1131357170 15:91755872-91755894 ACAATGGCAGAGTTGAGCTGTGG + Intergenic
1140919605 16:79525074-79525096 ATATTTTCAGAATCGTGCTGTGG - Intergenic
1141790113 16:86228644-86228666 ACAGTTGCAGAATCTTGGTGTGG - Intergenic
1146969726 17:37062884-37062906 CCACCTGCACAGTTGTGCTGAGG - Intergenic
1152123624 17:78433596-78433618 ACACTGACAGAGCCGTGGTGAGG + Intronic
1153499176 18:5730770-5730792 ACACTTGCAGGGACTGGCTGAGG + Intergenic
1153600271 18:6774166-6774188 ACACTTGCAGAGGGGTTTTGTGG + Intronic
1160157144 18:76442593-76442615 ACAGCGGCAGAGTCCTGCTGCGG - Exonic
1160197723 18:76770553-76770575 ACACTGTCAGAGTCAGGCTGGGG - Intergenic
1202631222 1_KI270706v1_random:1743-1765 ACACTTGTAGTGTTGTGCAGTGG + Intergenic
1202657727 1_KI270708v1_random:39382-39404 ACACTTGTAGTGTTGTGCAGTGG + Intergenic
925533171 2:4886275-4886297 AAACTTGTAGAGTCATGTTGAGG + Intergenic
925884098 2:8379728-8379750 ACACCTGCAGCGTGGTGCTCAGG + Intergenic
928697119 2:33860575-33860597 ACATTTCCAGAGTAATGCTGCGG - Intergenic
930544603 2:52750629-52750651 ACAGATGCAGAGGGGTGCTGAGG + Intergenic
937389294 2:121469318-121469340 CCGCATGCAGGGTCGTGCTGTGG - Intronic
943509623 2:188808506-188808528 ACACTTACAGAGGCCTGTTGGGG + Intergenic
945430281 2:209755566-209755588 ACACTAGCAAAGTGGTGGTGGGG - Intergenic
945541738 2:211096285-211096307 AGAATTGAAGAGTCTTGCTGTGG - Intergenic
946140809 2:217689113-217689135 ACAGGGGCAGAGTGGTGCTGTGG - Intronic
947717623 2:232349826-232349848 ACACCTGCAGAGTCGGGTCGGGG + Intergenic
1168757924 20:328673-328695 AGACTGGCGGAGTCCTGCTGTGG - Exonic
1171292676 20:23991229-23991251 AAGATTGCAGAGTCGTGCCGCGG - Intergenic
1173361406 20:42347678-42347700 ACATTTGCAATGTCGTGATGTGG - Intronic
1175745493 20:61454147-61454169 ACACAGGCAGACTCATGCTGCGG - Intronic
1176382858 21:6121784-6121806 ACACGTGCAGTGCCGTGGTGTGG + Exonic
1176643445 21:9327683-9327705 ACACTTGTAGTGTTGTGCAGTGG + Intergenic
1178789710 21:35688702-35688724 ACAATTTCAGAGTCGTGCTCTGG - Intronic
1179740611 21:43416455-43416477 ACACGTGCAGTGCCGTGGTGTGG - Exonic
1180369491 22:11971533-11971555 ACACTTGTAGTGTTGTGCAGTGG - Intergenic
1181124159 22:20692097-20692119 AAGATTGCAGAGTCGTGCCGCGG - Intergenic
1181210204 22:21284941-21284963 ATGATTGCAGAGTCGTGCCGCGG - Intergenic
1181650098 22:24254064-24254086 AAGATTGCAGAGTCGTGCCGCGG - Intergenic
1181707277 22:24656681-24656703 AAGATTGCAGAGTCGTGCCGCGG + Intergenic
1203273882 22_KI270734v1_random:74899-74921 ATGATTGCAGAGTCGTGCCGCGG - Intergenic
949394691 3:3602409-3602431 ACACTAGAAGTGTGGTGCTGGGG + Intergenic
951115504 3:18856659-18856681 ACACTTGCAGGGACGTGTTGAGG - Intergenic
951525739 3:23651098-23651120 AAGCTTGCAGAGTGGTGATGTGG - Intergenic
953139392 3:40213447-40213469 ACACTTGCAGTGTCATGCTGTGG + Intronic
953451305 3:43008675-43008697 ACACCTGTAGAGTCCTGGTGAGG - Intronic
954965581 3:54607481-54607503 TCACTTGGAGAGTCTTGCCGGGG - Intronic
957096592 3:75782535-75782557 ACACTTGTAGTGTTGTGCAGTGG - Intronic
958096872 3:88957357-88957379 ACACTTGCAAGGTAGTTCTGAGG - Intergenic
962715813 3:138125004-138125026 AAACTTGCAAAATCGGGCTGTGG - Intronic
964604139 3:158541018-158541040 ACCCATGCAGAGTGGTGATGTGG + Intronic
1202743437 3_GL000221v1_random:77346-77368 ACACTTGTAGTGTTGTGCAGTGG - Intergenic
978612777 4:110562556-110562578 AGATATGCAGAGTCATGCTGGGG - Exonic
978699084 4:111621342-111621364 ACCCTTGCAAAGACTTGCTGTGG - Intergenic
980002638 4:127508354-127508376 ACACTGGCAGTCTCCTGCTGTGG - Intergenic
981147449 4:141341710-141341732 ACATTTACAAAGTTGTGCTGGGG + Intergenic
981935634 4:150236329-150236351 AATCTTGCAGAATGGTGCTGTGG + Intronic
984004230 4:174289264-174289286 ACACTTCCAAAGTCATTCTGAGG - Intronic
991288909 5:65011783-65011805 ACCCTTGCAGAGGCAGGCTGTGG + Intronic
993782415 5:92084072-92084094 CCAATTGCAGAGTTGTTCTGTGG + Intergenic
994755013 5:103783718-103783740 ACATTTGCTAAGTCATGCTGTGG + Intergenic
995097106 5:108249829-108249851 ACACTAGGAAAGTCCTGCTGAGG + Intronic
1006472979 6:34238312-34238334 ACACTTGCAGAGTCACCCTCGGG + Intronic
1007010004 6:38407527-38407549 CCCCTTGCAGAGTCTAGCTGGGG + Intronic
1008457289 6:51725805-51725827 ACCCTTGCAGGGTTGTGCTAGGG + Intronic
1010842345 6:80661432-80661454 ACACTTCCTGAGGCATGCTGTGG + Intergenic
1011720120 6:90147450-90147472 ACACTTGGAGAGCCGTTCCGCGG + Intronic
1016593223 6:145769104-145769126 ACATTTGTATAGTCTTGCTGTGG + Intergenic
1017655515 6:156624760-156624782 ACAGATGCACAGTCATGCTGAGG - Intergenic
1017861425 6:158401596-158401618 ACCCGTGCAGAGTCAAGCTGTGG + Intronic
1019329508 7:455639-455661 ACACGTGCACAGACGGGCTGGGG + Intergenic
1021389733 7:20077011-20077033 AAACCTGCAGACTTGTGCTGGGG - Intergenic
1022693364 7:32680461-32680483 ACAGTTGCAGAGACTTGCAGTGG - Intergenic
1024209338 7:47190423-47190445 GCACTTGGAGTGTCATGCTGGGG - Intergenic
1026186573 7:68086396-68086418 ACTCTTCCAGAGCTGTGCTGTGG - Intergenic
1027247988 7:76380070-76380092 CCAGTTGCAGAGTCCTGGTGAGG - Intergenic
1032767117 7:135006657-135006679 ACACTTCCAAAGTTGTGCTGAGG - Intronic
1035307166 7:157940937-157940959 AGATTTGCAGTGTCGTGGTGGGG - Intronic
1035307180 7:157941026-157941048 AGATTTGCAGTGTCGTGGTGGGG - Intronic
1035307202 7:157941144-157941166 AGATTTGCAGTGTCGTGGTGGGG - Intronic
1035307208 7:157941175-157941197 AGATTTGCAGTGTCGTGGTGGGG - Intronic
1035307224 7:157941266-157941288 AGATTTGCAGTGTCGTGGTGGGG - Intronic
1035307233 7:157941326-157941348 AGATTTGCAGTGTCGTGGTGGGG - Intronic
1035943990 8:3938627-3938649 AGACTTGCAGTGACCTGCTGGGG - Intronic
1042441174 8:68828522-68828544 AGAGTTGCAAAGTGGTGCTGGGG + Intergenic
1044700381 8:94960318-94960340 AAAATAGCAGAGTCGTACTGAGG - Intronic
1045063158 8:98425550-98425572 ACATTTGCAGAGGCCTGCAGGGG + Intronic
1057142782 9:92737719-92737741 ACACTTGAAGAGTTGTTCTAAGG - Intronic
1059422439 9:114200673-114200695 ACACTTGGAGAGGCCAGCTGGGG + Intronic
1059914762 9:119086444-119086466 ACACTTGCAGACTTATACTGAGG + Intergenic
1062466052 9:136682143-136682165 GAGCTGGCAGAGTCGTGCTGGGG + Intronic
1203442030 Un_GL000219v1:17960-17982 ACACTTGCACACTGTTGCTGAGG + Intergenic
1203512838 Un_KI270741v1:136869-136891 ACACTTGCACACTGTTGCTGAGG + Intergenic
1203712072 Un_KI270742v1:107310-107332 ACACTTGTAGTGTTGTGCAGTGG - Intergenic
1196249245 X:113439949-113439971 TCACTTGCAGAATAGTGGTGTGG + Intergenic
1200923700 Y:8635530-8635552 AGACTTTTAGAGTCCTGCTGTGG + Intergenic