ID: 1068945327

View in Genome Browser
Species Human (GRCh38)
Location 10:62723777-62723799
Sequence GTGGCCCAGTAGAAGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068945320_1068945327 22 Left 1068945320 10:62723732-62723754 CCTGAGACTAGCACTTGATGGCT No data
Right 1068945327 10:62723777-62723799 GTGGCCCAGTAGAAGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068945327 Original CRISPR GTGGCCCAGTAGAAGTGTGG TGG Intergenic
No off target data available for this crispr