ID: 1068947730

View in Genome Browser
Species Human (GRCh38)
Location 10:62746548-62746570
Sequence TGTAGATTGGAAGCATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068947730_1068947736 14 Left 1068947730 10:62746548-62746570 CCCTCCAATGCTTCCAATCTACA No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068947730 Original CRISPR TGTAGATTGGAAGCATTGGA GGG (reversed) Intergenic
No off target data available for this crispr