ID: 1068947731

View in Genome Browser
Species Human (GRCh38)
Location 10:62746549-62746571
Sequence TTGTAGATTGGAAGCATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068947731_1068947736 13 Left 1068947731 10:62746549-62746571 CCTCCAATGCTTCCAATCTACAA No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068947731 Original CRISPR TTGTAGATTGGAAGCATTGG AGG (reversed) Intergenic
No off target data available for this crispr