ID: 1068947732

View in Genome Browser
Species Human (GRCh38)
Location 10:62746552-62746574
Sequence GCATTGTAGATTGGAAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068947732_1068947736 10 Left 1068947732 10:62746552-62746574 CCAATGCTTCCAATCTACAATGC No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068947732 Original CRISPR GCATTGTAGATTGGAAGCAT TGG (reversed) Intergenic
No off target data available for this crispr