ID: 1068947736

View in Genome Browser
Species Human (GRCh38)
Location 10:62746585-62746607
Sequence ACAGTACCACCCTTAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068947730_1068947736 14 Left 1068947730 10:62746548-62746570 CCCTCCAATGCTTCCAATCTACA No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data
1068947731_1068947736 13 Left 1068947731 10:62746549-62746571 CCTCCAATGCTTCCAATCTACAA No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data
1068947733_1068947736 1 Left 1068947733 10:62746561-62746583 CCAATCTACAATGCAAGACCCTA No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data
1068947732_1068947736 10 Left 1068947732 10:62746552-62746574 CCAATGCTTCCAATCTACAATGC No data
Right 1068947736 10:62746585-62746607 ACAGTACCACCCTTAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068947736 Original CRISPR ACAGTACCACCCTTAGATCC AGG Intergenic
No off target data available for this crispr