ID: 1068949040

View in Genome Browser
Species Human (GRCh38)
Location 10:62759182-62759204
Sequence CTGTTTGTGGATTTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068949036_1068949040 -1 Left 1068949036 10:62759160-62759182 CCCAAGCAATAGAGTAGTCTGTC No data
Right 1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG No data
1068949037_1068949040 -2 Left 1068949037 10:62759161-62759183 CCAAGCAATAGAGTAGTCTGTCT No data
Right 1068949040 10:62759182-62759204 CTGTTTGTGGATTTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068949040 Original CRISPR CTGTTTGTGGATTTGGAGCC AGG Intergenic
No off target data available for this crispr