ID: 1068949118

View in Genome Browser
Species Human (GRCh38)
Location 10:62759899-62759921
Sequence TTCCAGCCAGGCCTCCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068949118_1068949121 28 Left 1068949118 10:62759899-62759921 CCAACAGGGAGGCCTGGCTGGAA No data
Right 1068949121 10:62759950-62759972 AATAGCACACAGCGGAACCCTGG No data
1068949118_1068949120 20 Left 1068949118 10:62759899-62759921 CCAACAGGGAGGCCTGGCTGGAA No data
Right 1068949120 10:62759942-62759964 TTAGCATAAATAGCACACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068949118 Original CRISPR TTCCAGCCAGGCCTCCCTGT TGG (reversed) Intergenic
No off target data available for this crispr