ID: 1068951180

View in Genome Browser
Species Human (GRCh38)
Location 10:62779149-62779171
Sequence CACAAGGGCTCGAGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068951171_1068951180 14 Left 1068951171 10:62779112-62779134 CCTCGCCATGTGTGGTCAACAAT No data
Right 1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG No data
1068951174_1068951180 9 Left 1068951174 10:62779117-62779139 CCATGTGTGGTCAACAATGGGTG No data
Right 1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068951180 Original CRISPR CACAAGGGCTCGAGGGAAGT TGG Intergenic
No off target data available for this crispr