ID: 1068954264

View in Genome Browser
Species Human (GRCh38)
Location 10:62807077-62807099
Sequence ATTTTAGGGCACCAAAACTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068954264 Original CRISPR ATTTTAGGGCACCAAAACTT GGG Exonic