ID: 1068954264

View in Genome Browser
Species Human (GRCh38)
Location 10:62807077-62807099
Sequence ATTTTAGGGCACCAAAACTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068954264 Original CRISPR ATTTTAGGGCACCAAAACTT GGG Exonic
903747666 1:25599173-25599195 GTTTTAGGGCACTAAATGTTGGG + Intergenic
904244829 1:29180635-29180657 ATTTTAGGGCACTAAACCTTGGG - Intronic
906668377 1:47637738-47637760 ATTTTAAGCCACCAAGATTTGGG - Intergenic
910595095 1:88972553-88972575 ATTTTAGGCCACCAAGACTTTGG - Intronic
912183075 1:107241784-107241806 ATTTTAGGGCAAAAAAAGTCGGG + Intronic
912962967 1:114212415-114212437 ATATTAGGTCACAAAAACTCCGG + Intergenic
915259109 1:154663190-154663212 ATTTTAGGCCACCAGGCCTTTGG - Intergenic
918120596 1:181536051-181536073 ATTTTACAGCACCAAAAGTAAGG - Intronic
921268060 1:213442456-213442478 ATTTTAGGGGTAGAAAACTTGGG + Intergenic
923582901 1:235235381-235235403 ATATTAGGGGTCTAAAACTTGGG + Intronic
924803030 1:247341658-247341680 ATTTTCAGGAACCAAAAGTTAGG - Intergenic
1063077854 10:2734097-2734119 ATTTTTATCCACCAAAACTTTGG - Intergenic
1068454430 10:57236900-57236922 ATCTTAGGGCACCAAATTTCTGG + Intergenic
1068954264 10:62807077-62807099 ATTTTAGGGCACCAAAACTTGGG + Exonic
1069187554 10:65444427-65444449 ATTTTAAGGCACAATAACTGTGG - Intergenic
1071091108 10:81919708-81919730 ATTTTGGGACACCAAAACCAAGG + Intronic
1072444398 10:95485964-95485986 ATTGTAGGTCACAATAACTTTGG + Intronic
1075047986 10:119161015-119161037 ATTATAGGACACTAAAAATTAGG + Intronic
1077467529 11:2740625-2740647 ATTTTAGGCCACCAAAATTTTGG - Intronic
1079121796 11:17690802-17690824 ATTTTAGGCCACCAAATTTGTGG - Intergenic
1081457740 11:43241938-43241960 TTTTCATGGCACCAAAGCTTTGG + Intergenic
1083325227 11:61869692-61869714 ATATTGGGGCACCATGACTTTGG - Intergenic
1086424377 11:86669789-86669811 ATTTCAGGGGACCAAAACCTAGG + Intronic
1087540668 11:99514103-99514125 ATTTTAGGGGTCCAAGACTTCGG + Intronic
1087969100 11:104457175-104457197 ATTTGAGGGCCCCAAAATGTGGG - Intergenic
1088846075 11:113669281-113669303 AATTTAGGGAACCAAACCCTGGG - Intergenic
1088987707 11:114924691-114924713 ATTTTAGGGCACTGAAAGATGGG + Intergenic
1089193985 11:116680786-116680808 ATTTTAAAGCATCAAGACTTAGG - Intergenic
1090240736 11:125179765-125179787 ATTTTGGGGCAGAAAAACTGAGG - Intronic
1091662326 12:2393758-2393780 ATTTTAGGGAAGTAAAACTCAGG + Intronic
1092702913 12:11252960-11252982 ATTTTAAGGGACCGAAATTTTGG - Intergenic
1093621146 12:21290812-21290834 ATTTTAGTACAACAAAATTTAGG + Intronic
1094108481 12:26837134-26837156 TTTTTAGGGCATGATAACTTGGG - Intergenic
1094468572 12:30780824-30780846 ATTTTAAAGCACCAAAATGTTGG + Intergenic
1096705108 12:53415903-53415925 AGTCTAGGGCACAAAGACTTCGG + Intronic
1097767955 12:63547280-63547302 ATTTTAGGCCACTAAATTTTTGG - Intergenic
1098694145 12:73530093-73530115 AATTTCTGGCACCTAAACTTTGG - Intergenic
1098816788 12:75175743-75175765 ATCTTAGGCCACTAATACTTTGG + Intronic
1100092405 12:90986790-90986812 ATTTTAAGTAACCAAAATTTGGG + Intronic
1101021147 12:100555260-100555282 ATTTTAGGTAACCACAACTGAGG + Intronic
1101151659 12:101888535-101888557 ATTTTGGGGCTGCAAAAGTTTGG - Intronic
1107256080 13:38428171-38428193 ATTTCAGGGCCTCAAATCTTGGG + Intergenic
1109228383 13:59724536-59724558 CTTTTAGAGTGCCAAAACTTGGG - Intronic
1109458103 13:62619865-62619887 CTTTTGAGACACCAAAACTTTGG - Intergenic
1110011508 13:70340067-70340089 GATTTAGGACACCAACACTTAGG - Intergenic
1110936433 13:81295914-81295936 CTTTTAGGGCACAAACACTAAGG - Intergenic
1111436843 13:88222069-88222091 ATTTTAGGCCACCAAGTTTTTGG + Intergenic
1112476356 13:99734512-99734534 ATTTCAGGGCTCCCTAACTTGGG - Intronic
1114152626 14:20061972-20061994 ATTTTATGGCATGAAGACTTAGG + Intergenic
1115074563 14:29371390-29371412 AATTTTAGGCACCAAAACTGGGG + Intergenic
1115184709 14:30672716-30672738 GTATTAGGCCACCAAAACTGTGG + Intronic
1115665094 14:35536056-35536078 ATTTTAGGGGATTAAAACATAGG - Exonic
1116271149 14:42768925-42768947 ATTTTAGTGCACAAGAGCTTTGG + Intergenic
1117869349 14:60183576-60183598 ATTTTATGCCACCAAACTTTGGG + Intergenic
1118199291 14:63657440-63657462 ATTTTAAGGCACTAAAACATTGG - Intergenic
1121689054 14:95862670-95862692 ATTTTAAGTCACCAAATCATAGG - Intergenic
1125256942 15:37775277-37775299 ATTATAAGGAAGCAAAACTTTGG + Intergenic
1126320295 15:47415289-47415311 ATTTTAGAGCACTGAAATTTTGG - Intronic
1129381621 15:75171331-75171353 TTTTTGGGGCTCCAAAATTTTGG + Intergenic
1131359495 15:91777622-91777644 ATTGAAGTGCACCTAAACTTGGG - Intergenic
1133660838 16:7915893-7915915 GTTTCAGGGCAACAAAATTTTGG - Intergenic
1135601220 16:23785313-23785335 GTTTTAAGACACTAAAACTTGGG - Intergenic
1138663931 16:58546726-58546748 TTTTTAGGCCACCAAACCCTTGG - Exonic
1138757120 16:59501626-59501648 CTTTTAGGATACCAAATCTTGGG - Intergenic
1143843583 17:9754598-9754620 ATTTTATGACAACAAAACTATGG + Intergenic
1147130267 17:38403511-38403533 ACTTTAGGGCTCCAAAGCTAAGG - Exonic
1149227321 17:54489043-54489065 TTTTTAGGACACCTAAAATTAGG - Intergenic
1149516820 17:57287327-57287349 ATTATATGGCACCCAAACTCAGG - Intronic
1149953388 17:61017055-61017077 ATCTTAAGGCACCAATAATTTGG + Intronic
1153458213 18:5302664-5302686 ATTTTAGCTCACCATAACTATGG - Intergenic
1156484910 18:37458516-37458538 ATTTTTGGGGACCAACACATAGG + Intronic
1157852006 18:51063261-51063283 TTTTTTGGCCACCAAAACATTGG + Intronic
1157985563 18:52434275-52434297 ATTTTTGGTCACCACAACTAGGG + Intronic
1164041321 19:21494965-21494987 ATTTTAGGGCAACAGAACCCTGG + Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
929277009 2:40036517-40036539 ATTTTAGGGCACTAAGGGTTGGG + Intergenic
929594085 2:43165182-43165204 GTTTTAAGCCACCAAAACATTGG - Intergenic
930137420 2:47916243-47916265 TTTTTAGGGCATAAAAACTAGGG + Intergenic
930227086 2:48804970-48804992 ATTTTAAGACACCAAATTTTGGG - Intergenic
930567459 2:53039956-53039978 ATCTTTGGGCTCCAAAGCTTTGG - Intergenic
932340945 2:70962368-70962390 ATCCTAGGGCACCCACACTTGGG - Intronic
939565399 2:143781139-143781161 ATTTTAGGGCTTCCAAAATTTGG - Intergenic
939954521 2:148515638-148515660 ATTTTAGGGAATAAAAATTTTGG - Intronic
943091531 2:183381238-183381260 GTCTTAGTGCACAAAAACTTAGG - Intergenic
943119900 2:183722827-183722849 ATTTTAGGAAAACAAAACCTGGG + Intergenic
944505174 2:200403646-200403668 ATTTTAGGGCTCAGAAACATAGG - Intronic
945586409 2:211669450-211669472 GTTTCAGGAGACCAAAACTTAGG - Intronic
1170022640 20:11852893-11852915 ATTTTAGGGCACCAGGTCTTGGG + Intergenic
1170077909 20:12439833-12439855 ATTTTAAGTCACCAAATTTTAGG + Intergenic
1170257003 20:14356368-14356390 ATTTTAGGGCACCAATTTTGGGG - Intronic
1170547009 20:17442975-17442997 ATTTTGGGGAAACAAAACCTTGG - Intronic
1171021942 20:21592520-21592542 ATATTAGGGCCTCACAACTTTGG + Intergenic
1174699662 20:52595201-52595223 ATTTTTGGTCATCAAAACTAGGG + Intergenic
1174997352 20:55585455-55585477 GTTTTAAGGCACCAAAAGTGGGG - Intergenic
1175590323 20:60184721-60184743 TATTTAGAGCACCAAAGCTTTGG + Intergenic
1178966639 21:37126191-37126213 ATTGTAGGGCATCCAAATTTAGG - Intronic
1179231423 21:39507089-39507111 TTATTTGAGCACCAAAACTTGGG + Intronic
1179721439 21:43318389-43318411 AAATTTGGGCACCAAAATTTAGG + Intergenic
1181771027 22:25125687-25125709 ATTTTTGGGCATCACAACTGGGG - Intronic
1182311087 22:29407618-29407640 ATTTTAGAAGACCAAAACTCAGG - Intronic
1182690019 22:32153491-32153513 ATTTTAGAAGACCAAAACTCAGG + Intronic
1184772308 22:46604802-46604824 ACATTATGGCACCAAAACCTGGG - Intronic
1184772315 22:46604837-46604859 ACATTATGGCACCAAAACCTGGG - Intronic
1184772322 22:46604872-46604894 ACATTATGGCACCAAAACCTGGG - Intronic
1184772330 22:46604907-46604929 ACATTATGGCACCAAAACCTGGG - Intronic
1184772344 22:46604977-46604999 ACATTATGGCACCAAAACCTGGG - Intronic
1184772351 22:46605012-46605034 ACATTATGGCACCAAAACCTGGG - Intronic
1184772359 22:46605047-46605069 ACATTATGGCACCAAAACCTGGG - Intronic
1184772373 22:46605117-46605139 ACATTATGGCACCAAAACCTGGG - Intronic
1184772396 22:46605222-46605244 ATATTATGGCACCAAAACCTGGG - Intronic
949281225 3:2349867-2349889 ATTTCAGGGCACCAATCCTCAGG - Intronic
950846933 3:16023740-16023762 CTTTTGTGGCACCAAAATTTGGG - Intergenic
950853391 3:16083639-16083661 ATTGTAGTGAACCAAAAATTGGG - Intergenic
951061168 3:18208738-18208760 ATTTATGGGCACCAAAACCTAGG - Intronic
951406579 3:22307106-22307128 CTTTTAGGGCGCAGAAACTTTGG - Intronic
954097375 3:48339278-48339300 AAATTAGGACACCAAAAGTTTGG + Intergenic
955270760 3:57496303-57496325 ATTTTAAGGCACTAAATTTTGGG + Intronic
959385548 3:105701264-105701286 ATTTTAGGGGAAAAGAACTTGGG + Intronic
959711304 3:109388471-109388493 ATTTTTGGAAACCAAGACTTGGG - Intergenic
962328459 3:134456006-134456028 ATTTTTAGGGACCAAAACATAGG + Intergenic
963702484 3:148643754-148643776 ACTTTAGGGAACCAGGACTTAGG - Intergenic
963827015 3:149966876-149966898 ATTTTAGGGCAAAAAAATTCTGG + Intronic
965545667 3:169913856-169913878 ATTTTAAGGCAACACAAATTTGG + Intronic
965720986 3:171661977-171661999 ATTTCAGGGTCCCCAAACTTAGG - Intronic
970514803 4:16817933-16817955 GTTTTAGGCTACCAAAATTTTGG - Intronic
971109632 4:23570561-23570583 ATTTTAGGGGACACAAACATTGG + Intergenic
971377237 4:26064890-26064912 ATTTTAAGCCACAAAGACTTTGG - Intergenic
973817338 4:54631213-54631235 ATTTTTGGATACCAAAATTTAGG - Intergenic
976231497 4:82848194-82848216 ATTTTATGACACCAAACATTTGG + Intronic
976870694 4:89790007-89790029 GGTCTAGGGCACCAAGACTTAGG - Intronic
978048712 4:104167924-104167946 ATTTTAGTTCACCAAAAGTAAGG + Intergenic
978712130 4:111796969-111796991 AGTTTAGAGAACCATAACTTTGG + Intergenic
979417045 4:120454801-120454823 ATTTTAGGCCAGCAGAAATTTGG - Intergenic
980630199 4:135421470-135421492 ATCTTTGGGCACCTACACTTCGG - Intergenic
980828005 4:138095239-138095261 ATCTTATGACAACAAAACTTGGG - Intergenic
982656703 4:158158987-158159009 ATTTTAGATCACCAAATTTTTGG + Intronic
983290395 4:165796606-165796628 ATCTTAGGGCAAAAAAACTTTGG - Intergenic
983307856 4:166016882-166016904 ATTTTAGTTCCCCAAATCTTTGG + Intronic
984686776 4:182678314-182678336 ATTTTACTACAACAAAACTTAGG + Intronic
988103723 5:26716115-26716137 TTTTTAGGGCAATAAAAATTAGG - Intergenic
990270330 5:54130732-54130754 ATTTTTGGTAGCCAAAACTTAGG + Intronic
990875093 5:60475284-60475306 ACTTTAGGGCAACATAACCTTGG - Intronic
991138254 5:63208738-63208760 ATTTTAAAGAACCAAAACATTGG - Intergenic
994227782 5:97273876-97273898 ATTTTAGGGGGCCAACACTCAGG + Intergenic
995181469 5:109234531-109234553 ACTTTAGGGCACCATGACCTAGG - Intergenic
996392571 5:122977449-122977471 CTGTTAGGTCAACAAAACTTTGG + Intronic
997468842 5:134105347-134105369 AGTTTGGAGCCCCAAAACTTTGG + Intergenic
999317594 5:150594267-150594289 TCTTTAGGGAACAAAAACTTGGG + Intergenic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
999695298 5:154183534-154183556 TTTTTAGGGCAGTAAAACTGAGG + Intronic
1000734273 5:164879588-164879610 GTTTTAGGCCACTAAATCTTGGG + Intergenic
1003417408 6:5923770-5923792 CATTTAGGGCACCAAGATTTTGG - Intergenic
1004180516 6:13377059-13377081 ATTTTTTGAGACCAAAACTTAGG - Intronic
1005673644 6:28132402-28132424 ATTTTAGGAAACCTAATCTTAGG - Intergenic
1005945845 6:30595172-30595194 ATTCTCTGGCACCAAAGCTTGGG - Intronic
1008300244 6:49828980-49829002 ATTTTATGGCATCTAAATTTTGG + Intergenic
1009860413 6:69323112-69323134 ATTTCAGTACACCAACACTTAGG + Intronic
1010470596 6:76223084-76223106 ATTTTATAGCAGCAAAACTAAGG - Intergenic
1010735037 6:79434709-79434731 ATACTTGTGCACCAAAACTTAGG - Intergenic
1010739063 6:79478581-79478603 ATTTTATGGCACCTGAACCTTGG + Intergenic
1010807009 6:80249186-80249208 ATTTTTGGTCACCACAACTGGGG - Intronic
1014940716 6:127435460-127435482 AATTTAGTGCAGCAAAAATTAGG + Intergenic
1016897711 6:149069767-149069789 ATTTCAGGCCAGAAAAACTTTGG - Intronic
1018593795 6:165456002-165456024 GTTTGAGGTCACCAAAACTTAGG + Intronic
1018747608 6:166774593-166774615 ATTTCCTGGCACCAGAACTTAGG + Intronic
1020077844 7:5270328-5270350 ATTTTATGGCACCTCAATTTGGG - Intergenic
1024925352 7:54607235-54607257 ATTTTAAGCCACCAAACGTTTGG + Intergenic
1025201043 7:56961842-56961864 ATTTTATGGCACCTCAATTTGGG + Intergenic
1025670901 7:63615090-63615112 ATTTTATGGCACCTCAATTTGGG - Intergenic
1030666065 7:112280132-112280154 ATTTCAGGGCACCACACCTGAGG + Intronic
1031599687 7:123691804-123691826 ATTTTAGAACATGAAAACTTTGG + Intronic
1036043263 8:5110096-5110118 ATTAAATGCCACCAAAACTTAGG - Intergenic
1036092313 8:5680669-5680691 ATTTTATGTGTCCAAAACTTTGG - Intergenic
1036965450 8:13292426-13292448 ATTTTCGAACACCAAAATTTGGG - Intronic
1046979124 8:120317361-120317383 ATTTTAGGCAAACAAAAGTTTGG - Intronic
1050080199 9:1907919-1907941 AATTTGGGGCACCAAAAGGTTGG - Intergenic
1050167666 9:2782902-2782924 ATTAGAGGGCATCAAAACTTGGG + Intronic
1051405181 9:16729628-16729650 ATTTTAAGGCAACAATTCTTTGG - Intronic
1057095030 9:92298607-92298629 AATTTATGGCACTAAAACTTAGG + Intronic
1057757668 9:97851037-97851059 ATTTTCAGGCACAAAATCTTAGG + Intergenic
1058825592 9:108773639-108773661 ATTTTAAGCCACCAAATTTTGGG - Intergenic
1059677416 9:116552750-116552772 GTTTTAGGGCACCAGGCCTTGGG - Intronic
1059981466 9:119777099-119777121 ATTTAAGTGCACAGAAACTTGGG - Intergenic
1193983668 X:88214193-88214215 CTTTTATGGAACCAAAACCTGGG - Intergenic
1194275031 X:91868064-91868086 ATTTTTGGTCACTAAAACATTGG - Intronic
1194642197 X:96415564-96415586 ATTTTAGTCCAGCAAAACTGAGG + Intergenic
1194911760 X:99653892-99653914 ACTTTAAGCCACCAAAACATTGG + Intergenic
1195768593 X:108323511-108323533 ATTTAAGGGCACTCAAAATTAGG + Intronic
1195862219 X:109394596-109394618 ATTACAGGACACCAAAACTGAGG - Intronic
1195920238 X:109976413-109976435 ATTTCAGGGGACCAAGACTTGGG - Intergenic
1199201498 X:145095131-145095153 AATCTAGGGCACAAAGACTTTGG + Intergenic
1200592273 Y:5089466-5089488 ATTTTTGGTCACTAAAACATTGG - Intronic
1201577925 Y:15479856-15479878 ATTTTTGGTCATCAGAACTTTGG + Intergenic