ID: 1068954538

View in Genome Browser
Species Human (GRCh38)
Location 10:62810678-62810700
Sequence ACGCCAACAAGCTGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068954535_1068954538 5 Left 1068954535 10:62810650-62810672 CCAAAGTTGGACAAGCAAGGATG No data
Right 1068954538 10:62810678-62810700 ACGCCAACAAGCTGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068954538 Original CRISPR ACGCCAACAAGCTGGGAAAT AGG Intergenic
No off target data available for this crispr