ID: 1068954718

View in Genome Browser
Species Human (GRCh38)
Location 10:62812778-62812800
Sequence GATGCTGATCCCTTCAAGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068954718_1068954724 24 Left 1068954718 10:62812778-62812800 CCCCACTTGAAGGGATCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1068954724 10:62812825-62812847 TTAGATCAACTCTGACATCCAGG 0: 1
1: 0
2: 0
3: 10
4: 112
1068954718_1068954725 25 Left 1068954718 10:62812778-62812800 CCCCACTTGAAGGGATCAGCATC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1068954725 10:62812826-62812848 TAGATCAACTCTGACATCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068954718 Original CRISPR GATGCTGATCCCTTCAAGTG GGG (reversed) Exonic
902044675 1:13515281-13515303 GAAGCTGAGCCCTTGAAGTTGGG - Intergenic
906650031 1:47506478-47506500 GATGATGCTCCCTTCATGTTAGG - Intergenic
910106357 1:83635195-83635217 GAAGAAAATCCCTTCAAGTGTGG + Intergenic
912562034 1:110557850-110557872 GATGCTGCTCCCTTCAGTGGAGG + Intergenic
913519247 1:119630404-119630426 GATGCAGATCACTTCAAGGTGGG + Intronic
914848303 1:151295002-151295024 GTTGTTGTTCCCTTCCAGTGAGG - Intronic
914997443 1:152557432-152557454 GAAGCTGATTCCTACAAGTGAGG - Intronic
915658911 1:157384640-157384662 GTTGCTGATTCCTGAAAGTGGGG - Intergenic
920300879 1:204988025-204988047 GATGCTGAGCTCTTGAGGTGGGG - Intronic
924044187 1:240011060-240011082 GATGAAGATCACTTCAAGAGTGG - Intergenic
924592105 1:245413861-245413883 GATGCTGATCCATTCGGCTGAGG - Intronic
1066027909 10:31383268-31383290 GCTGCTGAGCCCTTAAAATGTGG + Intronic
1067682489 10:48449802-48449824 GATTCTGATCCCATCAAGGAAGG + Intronic
1068954718 10:62812778-62812800 GATGCTGATCCCTTCAAGTGGGG - Exonic
1069299084 10:66884298-66884320 GATGCACCTCCCTTCAAGAGTGG + Intronic
1074171488 10:110943346-110943368 GCTGTTGAACCCTTCTAGTGAGG + Intronic
1078870472 11:15339567-15339589 CATGCTGTTCCTTTTAAGTGGGG + Intergenic
1081301517 11:41458319-41458341 GATTCTGTTGCCTTCATGTGAGG + Intronic
1081728148 11:45347460-45347482 GCTGATGATACCTTCCAGTGTGG - Intergenic
1084067665 11:66714637-66714659 GGTGCTGGTCCCTCCAGGTGGGG + Intronic
1090640807 11:128727440-128727462 GATGCTGATCTCAGCAAGTCAGG + Intronic
1092050338 12:5465151-5465173 GATGCTTCTCCCATGAAGTGGGG - Intronic
1093925930 12:24908363-24908385 GCTACTGAGCACTTCAAGTGTGG + Intronic
1094265263 12:28551554-28551576 GATGGTGATGCCTACAAGTAAGG - Intronic
1094315330 12:29133269-29133291 GTTGCTCATCCCTTCAAAAGTGG + Intergenic
1096203525 12:49703563-49703585 GAAGCTGATCCCATCCAGAGGGG + Intronic
1100045015 12:90369122-90369144 TTTGCTGAACCCTGCAAGTGTGG - Intergenic
1105945744 13:25187967-25187989 GATGGGGATCCCTGCAAGTCTGG - Intergenic
1118306690 14:64660975-64660997 GATGCTGGACCCATAAAGTGGGG + Intergenic
1118429245 14:65699535-65699557 GATGCTGATACCTACAAGGTGGG + Intronic
1119102369 14:71891636-71891658 GATGCTTCTCCCATCAAATGTGG - Intergenic
1121617143 14:95320381-95320403 GGTCCTGGTCCCTCCAAGTGGGG - Intergenic
1123928157 15:25139258-25139280 TGTGTTGATACCTTCAAGTGTGG - Intergenic
1129071537 15:72955354-72955376 GGTGCTGATCCATTCAACAGTGG - Intergenic
1133232315 16:4372510-4372532 GATGCCCATCCCTCCAGGTGGGG + Intronic
1133980843 16:10632222-10632244 GATACTGAGCCCTTGAAATGTGG + Intronic
1145077741 17:19869306-19869328 CAGGCTGATCCCTTGAAGTTGGG - Intergenic
1147683719 17:42274614-42274636 GGTTCTGATCACTTCAAATGGGG - Intronic
1152078805 17:78174148-78174170 GGGGCTTATCTCTTCAAGTGTGG - Exonic
1156256737 18:35405206-35405228 GATGCTGAGACCATCCAGTGGGG + Intergenic
1158830702 18:61274736-61274758 GATGCTTATCACTTGAAGTTAGG - Intergenic
1160139035 18:76302876-76302898 GATGTTGATCACTTCATGTGAGG - Intergenic
1160238365 18:77103891-77103913 GAAGCTGATGCCTTCAAATAAGG + Intronic
1163276252 19:16286231-16286253 GATCCTGTTCCCTTCCAGGGAGG + Intergenic
1164388152 19:27794322-27794344 GATGCTGGTCCCTTGAGGGGGGG + Intergenic
1166378410 19:42341889-42341911 GATGCTTATACCTGCAAGTTGGG + Intronic
925423188 2:3728055-3728077 AATGCTGAGCTCTTCATGTGGGG + Intronic
929322397 2:40560044-40560066 GAAGCTGATTTCTTCAAATGAGG - Intronic
931367355 2:61630356-61630378 GGTGTTCATACCTTCAAGTGGGG - Intergenic
936040778 2:109147506-109147528 AGTGCTAATTCCTTCAAGTGTGG - Intronic
939111779 2:138017237-138017259 GAGGCAGATCCCTTAAGGTGGGG - Intergenic
941450479 2:165654585-165654607 GATGATGATCCCTGCCTGTGTGG - Intronic
941977060 2:171416988-171417010 GATGCTGAACCCTACATCTGAGG + Intronic
949071847 2:242029995-242030017 GGTACTGAGCCCTTCAATTGAGG - Intergenic
1168808206 20:685351-685373 GATGGTGAACTCTTCAAGGGCGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178197661 21:30367020-30367042 GAGGCTCATAACTTCAAGTGTGG - Intronic
1178319526 21:31594776-31594798 GACGCTAATCCCATCAAGAGAGG - Intergenic
1178377473 21:32079097-32079119 GATGCTGTTCCAATTAAGTGAGG - Intergenic
1178406675 21:32329934-32329956 GATGCTGGCCCCTTCTAGGGAGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1180150302 21:45943865-45943887 GATGCGGAACACTTCAGGTGGGG + Intergenic
1184340777 22:43884819-43884841 GATGCTGGTCCCTTCCACTCTGG - Intronic
950535952 3:13578224-13578246 GATTCTGCTCCCTCAAAGTGGGG - Intronic
952121527 3:30250168-30250190 GAGGCTGAGCCCTCCAACTGGGG - Intergenic
952836436 3:37606380-37606402 GCTGCTGAGCCCTTGAAATGTGG + Intronic
953135542 3:40178688-40178710 GATACTGATCCCTTAACATGAGG + Intronic
963239096 3:142985124-142985146 GCTGCTGAGCCCTTGAAATGTGG + Intronic
968051277 3:195656705-195656727 GGTACTGAGCCCTTCAATTGAGG - Intergenic
968104547 3:195991634-195991656 GGTACTGAGCCCTTCAATTGAGG + Intergenic
968302838 3:197629217-197629239 GGTACTGAGCCCTTCAATTGAGG + Intergenic
969000268 4:3975124-3975146 GCTGCTGAGCCCTTGAAATGTGG - Intergenic
969317653 4:6391630-6391652 GAAGCTGAAACCTCCAAGTGTGG + Intronic
973969774 4:56201437-56201459 GATGCTCTTCCCTTAAACTGAGG + Intronic
974878859 4:67729990-67730012 GATGCTAATCCCATCATGAGGGG - Intergenic
974932811 4:68378751-68378773 GATGCTGTGCCCTTCATGTCCGG + Intergenic
975794232 4:77989302-77989324 GCTACTGAGCTCTTCAAGTGTGG - Intergenic
976024859 4:80675180-80675202 GATGCTGATGCCTACAGATGGGG + Intronic
977927075 4:102713412-102713434 TACACTGATCCCTTCATGTGTGG - Intronic
978598159 4:110401112-110401134 GATTCTGATTCGTTCAATTGAGG + Intronic
981460479 4:145008326-145008348 GATGCTGACCTCATCAAATGAGG - Intronic
985241397 4:187934278-187934300 GATGCTGAACCCTGCAATTTGGG - Intergenic
985253742 4:188048728-188048750 GATGCTCATTCCTCCAAGTGCGG - Intergenic
985894789 5:2742152-2742174 GAGGCTGATGCATACAAGTGGGG + Intergenic
987113187 5:14705878-14705900 GATGCTGGTTCCCTGAAGTGTGG - Exonic
988798013 5:34670036-34670058 GATGCTACTCCATTCCAGTGAGG + Intronic
990036181 5:51323121-51323143 GTTGCAGACCCCTTCAAATGTGG - Intergenic
992503074 5:77360512-77360534 GAAACTGATTCCTTCATGTGAGG - Intronic
997468759 5:134104966-134104988 CATGCTATTCCCTGCAAGTGAGG + Intergenic
998731263 5:145080176-145080198 GATCCTAATGCCTTCATGTGGGG + Intergenic
999148369 5:149410614-149410636 GAAACTGATGGCTTCAAGTGTGG - Intergenic
1004678515 6:17868763-17868785 GATGCTGATCACTTGAGGTCAGG + Intronic
1005711127 6:28503665-28503687 GATGCCCTTCCCTTCATGTGAGG + Exonic
1007921536 6:45614634-45614656 GTTGCTGAGCACTTAAAGTGTGG - Intronic
1010840159 6:80639540-80639562 GATGCTGATGCCTTGATGAGTGG + Intergenic
1016700358 6:147047608-147047630 GGTGCTGAGCCATTCAAGAGGGG - Intergenic
1019323878 7:428498-428520 GCTGCTGAGCCCTTGAAATGTGG - Intergenic
1023901496 7:44484221-44484243 GGAGCTGATCCCTTCTTGTGTGG - Intronic
1024418638 7:49137063-49137085 TATGCTGATGCTTCCAAGTGAGG + Intergenic
1032259865 7:130326775-130326797 AATGATGATTCCTTCAAATGGGG + Intergenic
1032432582 7:131873790-131873812 CATTCTGATCCCTGCAAGAGGGG - Intergenic
1035261474 7:157664270-157664292 GATGCTGTAACCTTCAACTGAGG - Intronic
1036012834 8:4747043-4747065 GATGGTGATCCATTCTGGTGGGG - Intronic
1037319798 8:17631739-17631761 GAGGCTGTTCCCTGCAGGTGAGG - Intronic
1038639935 8:29315692-29315714 GATGCAGGTCCCTTTAAGGGTGG - Intergenic
1043050559 8:75380176-75380198 GATGCTGATCCAAGAAAGTGAGG + Intergenic
1046525444 8:115377085-115377107 GATGCTGATGCCATTTAGTGAGG + Intergenic
1046807684 8:118498272-118498294 GATGCTGTTCCCTTGAAGACAGG + Intronic
1048954825 8:139527033-139527055 GATGGTGATCCCTTCAAGGTAGG + Intergenic
1051227772 9:14920539-14920561 TATGCTGATCCCTTCAACGAGGG + Intergenic
1058274798 9:103026416-103026438 GATGCTGATTCCTGCATTTGAGG - Intergenic
1060613604 9:124990920-124990942 GATTCTGATCACTTCACCTGGGG - Intronic
1186608342 X:11114052-11114074 GATGCTGATCCCAATTAGTGAGG - Intronic
1186761757 X:12730342-12730364 GATGCTATTCCCTCCATGTGTGG + Intergenic