ID: 1068955276

View in Genome Browser
Species Human (GRCh38)
Location 10:62815326-62815348
Sequence CAACTTCGCGGGCGGCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068955259_1068955276 11 Left 1068955259 10:62815292-62815314 CCGCCGGCCGGAGCCCCCGCCTT 0: 1
1: 0
2: 1
3: 28
4: 180
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955260_1068955276 8 Left 1068955260 10:62815295-62815317 CCGGCCGGAGCCCCCGCCTTACT 0: 1
1: 0
2: 2
3: 15
4: 118
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955265_1068955276 -5 Left 1068955265 10:62815308-62815330 CCGCCTTACTAACCCCCTCAACT 0: 1
1: 0
2: 0
3: 17
4: 171
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955262_1068955276 -2 Left 1068955262 10:62815305-62815327 CCCCCGCCTTACTAACCCCCTCA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955258_1068955276 14 Left 1068955258 10:62815289-62815311 CCTCCGCCGGCCGGAGCCCCCGC 0: 1
1: 1
2: 4
3: 66
4: 573
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955256_1068955276 24 Left 1068955256 10:62815279-62815301 CCACTCGCTGCCTCCGCCGGCCG 0: 1
1: 0
2: 4
3: 28
4: 287
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955255_1068955276 25 Left 1068955255 10:62815278-62815300 CCCACTCGCTGCCTCCGCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 194
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955261_1068955276 4 Left 1068955261 10:62815299-62815321 CCGGAGCCCCCGCCTTACTAACC 0: 1
1: 0
2: 2
3: 4
4: 85
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955263_1068955276 -3 Left 1068955263 10:62815306-62815328 CCCCGCCTTACTAACCCCCTCAA No data
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955266_1068955276 -8 Left 1068955266 10:62815311-62815333 CCTTACTAACCCCCTCAACTTCG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955264_1068955276 -4 Left 1068955264 10:62815307-62815329 CCCGCCTTACTAACCCCCTCAAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data
1068955253_1068955276 28 Left 1068955253 10:62815275-62815297 CCACCCACTCGCTGCCTCCGCCG 0: 1
1: 0
2: 0
3: 21
4: 352
Right 1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068955276 Original CRISPR CAACTTCGCGGGCGGCGGGC AGG Intronic
No off target data available for this crispr