ID: 1068955637

View in Genome Browser
Species Human (GRCh38)
Location 10:62817190-62817212
Sequence CTTCAGCTGCTGCGCGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068955626_1068955637 -4 Left 1068955626 10:62817171-62817193 CCGCGCGCTCCCCGCCCCCCTTC 0: 1
1: 0
2: 7
3: 117
4: 949
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955623_1068955637 7 Left 1068955623 10:62817160-62817182 CCTTCCTCTGCCCGCGCGCTCCC 0: 1
1: 0
2: 2
3: 60
4: 432
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955625_1068955637 -3 Left 1068955625 10:62817170-62817192 CCCGCGCGCTCCCCGCCCCCCTT 0: 1
1: 0
2: 6
3: 38
4: 467
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955620_1068955637 20 Left 1068955620 10:62817147-62817169 CCGGAGACACCCTCCTTCCTCTG No data
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955619_1068955637 26 Left 1068955619 10:62817141-62817163 CCTCAGCCGGAGACACCCTCCTT 0: 1
1: 0
2: 1
3: 15
4: 147
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955622_1068955637 10 Left 1068955622 10:62817157-62817179 CCTCCTTCCTCTGCCCGCGCGCT 0: 1
1: 0
2: 3
3: 19
4: 260
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955621_1068955637 11 Left 1068955621 10:62817156-62817178 CCCTCCTTCCTCTGCCCGCGCGC 0: 1
1: 0
2: 1
3: 26
4: 274
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data
1068955624_1068955637 3 Left 1068955624 10:62817164-62817186 CCTCTGCCCGCGCGCTCCCCGCC 0: 1
1: 0
2: 12
3: 97
4: 793
Right 1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068955637 Original CRISPR CTTCAGCTGCTGCGCGGAGC GGG Intronic
No off target data available for this crispr