ID: 1068956583

View in Genome Browser
Species Human (GRCh38)
Location 10:62823928-62823950
Sequence TACCTGGATTGCCCTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068956583_1068956589 -5 Left 1068956583 10:62823928-62823950 CCAGATGCAGGGCAATCCAGGTA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1068956589 10:62823946-62823968 AGGTAGCCTGGGGAATGGAAAGG No data
1068956583_1068956587 -10 Left 1068956583 10:62823928-62823950 CCAGATGCAGGGCAATCCAGGTA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1068956587 10:62823941-62823963 AATCCAGGTAGCCTGGGGAATGG No data
1068956583_1068956591 3 Left 1068956583 10:62823928-62823950 CCAGATGCAGGGCAATCCAGGTA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1068956591 10:62823954-62823976 TGGGGAATGGAAAGGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068956583 Original CRISPR TACCTGGATTGCCCTGCATC TGG (reversed) Intronic
903555045 1:24187188-24187210 TACCTGGAGCGGCCTGCAGCAGG + Exonic
908007170 1:59738929-59738951 TGCCTGGATTCCCCTGTATCTGG - Intronic
910928576 1:92420724-92420746 TAACTGGGTCGCCCTGCCTCAGG - Intergenic
915375773 1:155393905-155393927 TCCCTGGATTTCCCAGCACCTGG - Intronic
915561888 1:156692571-156692593 CACTTGGTTTCCCCTGCATCGGG - Intergenic
918204573 1:182297529-182297551 TGCCTGGATTGCCCTTAATCTGG - Intergenic
918657665 1:187048239-187048261 TATCTGTTTTGCCCTGCAACAGG + Intergenic
921830878 1:219725849-219725871 TACATGGATTTCTATGCATCTGG - Intronic
923070675 1:230561896-230561918 CACCTGGATTGGGCTGCATTGGG - Intergenic
1062939506 10:1410883-1410905 TGACTGGACTGCCCTCCATCCGG - Intronic
1067304731 10:45051116-45051138 TTCCTGGCTTGCCCTCCTTCAGG + Intergenic
1067452381 10:46390275-46390297 GAGCTGGTCTGCCCTGCATCTGG - Intronic
1067584853 10:47469480-47469502 GAGCTGGTCTGCCCTGCATCTGG + Intronic
1068956583 10:62823928-62823950 TACCTGGATTGCCCTGCATCTGG - Intronic
1070419018 10:76218052-76218074 TCCCTGGATTGGATTGCATCAGG - Intronic
1073453237 10:103621824-103621846 TCCCTGGACTCCCCTGGATCAGG + Intronic
1074420179 10:113301573-113301595 TTCCCAGATTTCCCTGCATCTGG - Intergenic
1074658189 10:115618908-115618930 TACCTGGATGTCTGTGCATCTGG + Intronic
1075573446 10:123561264-123561286 TACCTGGATGGGCCTGCCTCAGG + Intergenic
1085565548 11:77509964-77509986 TAGCTGGAATGCCCTGAATTTGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1092145938 12:6214778-6214800 TACCAGGAGTGCCCTGCTGCAGG + Intronic
1092555862 12:9561016-9561038 TGCCTGCCTTGCCCTGCCTCTGG + Intergenic
1093950473 12:25160493-25160515 TACCTGCTCTGCCCTGAATCCGG + Intronic
1094101313 12:26767125-26767147 TTCCTTGATGGCCCTGCAGCAGG + Intronic
1094516238 12:31129654-31129676 TGCCTGCCTTGCCCTGCCTCTGG - Intergenic
1097840507 12:64316962-64316984 TCCCTGAATTGCCCAGCTTCAGG - Intronic
1099773624 12:87096915-87096937 TACAGGGATTGCCCTACATATGG + Intergenic
1112956389 13:105064036-105064058 TACCCAAATTGCTCTGCATCTGG - Intergenic
1124021841 15:25932626-25932648 TACCTGAATTGTCCAGCTTCTGG - Intergenic
1136271998 16:29153845-29153867 TACCTGGAGTGCCCAGGAGCTGG - Intergenic
1137580880 16:49632802-49632824 TCCCTGGAGTGCTCTGCATCCGG - Intronic
1137938692 16:52659368-52659390 TACCTTGATTTCTGTGCATCTGG - Intergenic
1139262269 16:65606028-65606050 AAATTGGAATGCCCTGCATCAGG - Intergenic
1140210572 16:72966690-72966712 TAGCTGCCTTGCCCTGCAACGGG - Intronic
1142075602 16:88115831-88115853 TACCTGGAGTGCCCAGGAGCTGG - Intronic
1142371629 16:89686180-89686202 TACCTGGAGGGCCCTTCACCTGG + Intronic
1142371669 16:89686283-89686305 TACCTGGAGGGCCCTTCACCTGG + Intronic
1148349244 17:46928008-46928030 TCCCTTGGTTGCCCTGCTTCAGG + Intronic
1150525638 17:65919530-65919552 TGGCTGGATTTCCCTGTATCAGG - Intronic
1151246005 17:72795200-72795222 TAGCTGGATGGCCCTGGCTCGGG + Intronic
1161586152 19:5106933-5106955 GCCCTGGATTGCCCTGCCTTGGG - Intronic
1164680833 19:30132686-30132708 TGCCAGGATTCCCCTGCATCAGG - Intergenic
1165594524 19:37001044-37001066 CTCCTAGCTTGCCCTGCATCTGG + Intergenic
1168702037 19:58446275-58446297 TACCATGATCGCCCTGCATGTGG + Intergenic
926755940 2:16235912-16235934 TGCCTGGAATGACTTGCATCTGG - Intergenic
928456444 2:31426954-31426976 TACATGGATTGCCTTGCCTGGGG + Intergenic
928953708 2:36839294-36839316 CACCTGGAATGTGCTGCATCAGG + Intergenic
938130661 2:128713624-128713646 TTCCTGGAGTGCCCTGCTCCTGG + Intergenic
938688822 2:133767382-133767404 TACTTGAATTTCCCTGCATTTGG - Intergenic
938755299 2:134373755-134373777 TGCCTGGACTGCACTGCCTCAGG - Intronic
939880295 2:147623704-147623726 CACCTGTATGGCCCTGCTTCAGG + Intergenic
941093543 2:161208594-161208616 TACCTGGGTGGCCCTGACTCAGG + Intronic
941178051 2:162224024-162224046 TATAAGGATTACCCTGCATCTGG + Intronic
942182558 2:173394304-173394326 TCTCTGGCTTGCTCTGCATCTGG + Intergenic
944624621 2:201558687-201558709 TAGCTGCATTGCCCTGGATTAGG + Intronic
946014729 2:216594759-216594781 TACATGGAATGCCATGGATCAGG - Intergenic
946217032 2:218192427-218192449 TACCTGGCTGGCCTTGCTTCAGG - Intergenic
947640973 2:231707829-231707851 GACCTCGATTGCCCACCATCAGG - Intronic
1172039148 20:32031474-32031496 TACCTGGAGTGTCCTGCAGGGGG + Exonic
1173715489 20:45199932-45199954 CAGCTGTATTGCCCTGCATTAGG - Intergenic
1174161628 20:48555015-48555037 CACCTGGATTATCCTGAATCCGG - Intergenic
1178077062 21:29022207-29022229 TACTTAGATTGCCCTGTAACTGG + Intergenic
1179343066 21:40531008-40531030 TACAAGGAGTGCCCTGCTTCTGG + Intronic
1180116018 21:45705535-45705557 TACCTGGCTTGACCTGCTTAAGG + Intronic
953420397 3:42749520-42749542 TGCCAGCATTGCCCTCCATCAGG - Intronic
953563508 3:44012723-44012745 TAGCTGGATTGCGCTTCATGAGG - Intergenic
960030902 3:113053838-113053860 TAGCTGGATTCCTCTGCCTCCGG - Intergenic
960054836 3:113269838-113269860 TACCTGGGTGGCCCAGCAGCAGG + Intronic
961363100 3:126380350-126380372 TGCCTGGGTCTCCCTGCATCAGG + Intergenic
963458499 3:145577107-145577129 AACCTGGATAGCCCTACATCAGG - Intergenic
967106211 3:186256782-186256804 TGCCTGGACTGCCCTTCCTCAGG + Intronic
967922797 3:194625289-194625311 TGCCTGGAGTGCCCTGCCTGTGG + Intronic
970852031 4:20614261-20614283 TACATGGATTTCCATGCATGGGG - Intronic
972366188 4:38377278-38377300 TACCTGGATGCCCATGCATGTGG - Intergenic
979153461 4:117350808-117350830 AACCTGGATTTCCCTGGCTCAGG - Intergenic
980614821 4:135205938-135205960 AACCTGGATTGCCTTGCCTGAGG + Intergenic
983227879 4:165101834-165101856 TTCCTGGCTTCCCCTGCAGCTGG - Intronic
984063318 4:175019079-175019101 TACCTCCAGTGCCCTGTATCAGG - Intergenic
985641927 5:1067471-1067493 AACCTGAATTGCCCTGCAGAGGG - Intronic
985851784 5:2393710-2393732 TACCTGGATTTCTCTCCATGTGG + Intergenic
987003142 5:13681608-13681630 TACCTGAATTGACCTGTAACAGG + Intergenic
993111665 5:83664209-83664231 TCCCTGGAATGCTCTGCCTCTGG + Intronic
993942760 5:94080697-94080719 TATCGGGGTTGTCCTGCATCAGG - Intronic
995378791 5:111509539-111509561 TTCCTGGATTCCCCTGAACCTGG + Intronic
1000186961 5:158868411-158868433 TACTTGCATTGCACTTCATCTGG + Intronic
1001700617 5:173704130-173704152 GACTTGGATTGACCTTCATCTGG - Intergenic
1003700786 6:8462620-8462642 TTCCTGGATGGCCCTGCAGAAGG + Intergenic
1008436225 6:51479513-51479535 TTCCTGGACTGCTCTGCATCAGG - Intergenic
1014781932 6:125574630-125574652 TCCCAGGACTGCCCTGCCTCTGG - Intergenic
1016052435 6:139544087-139544109 TATGTGGATTCCCCCGCATCTGG - Intergenic
1018480116 6:164181589-164181611 GACCTGGAAGCCCCTGCATCAGG + Intergenic
1020285874 7:6680152-6680174 TACCTGGATTTCCTTGCAGCAGG + Intergenic
1021262289 7:18472985-18473007 TATCTGGATTGCTGTGCATATGG - Intronic
1024963070 7:54997551-54997573 TAGCTGGCTGGCCCTCCATCAGG + Intergenic
1025026700 7:55522183-55522205 TGCCACGATTGCCCTGCAGCTGG + Intronic
1025249599 7:57343123-57343145 TACCAGGAATGCCCTTCCTCTGG + Intergenic
1034890854 7:154838031-154838053 TCCCTGGAGTGCCCTGCAAGTGG - Intronic
1041807696 8:61871403-61871425 TACCTGGATTGGGTTGCAACGGG + Intergenic
1046431295 8:114132529-114132551 TACCTTGATTTCTGTGCATCTGG + Intergenic
1048797849 8:138167894-138167916 TACGTGGACTGCCCTGCGACAGG - Exonic
1060517710 9:124276185-124276207 TACCTGGAGACCCCTGGATCAGG + Intronic
1062056951 9:134473737-134473759 TGCCTGGACTGCCCTCCATCCGG + Intergenic
1197942726 X:131806315-131806337 TGCCTGGATTGTCAAGCATCTGG + Intergenic
1199257161 X:145729964-145729986 TATATGCATTGCCCAGCATCTGG - Intergenic
1199692769 X:150321179-150321201 TACCTGGATTTCTCAGCATAAGG - Intergenic
1200084308 X:153595871-153595893 TACCTGGATGGCCTTGAACCAGG - Intronic