ID: 1068959983

View in Genome Browser
Species Human (GRCh38)
Location 10:62857651-62857673
Sequence GTGCTCACTGAACCTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068959983_1068959985 28 Left 1068959983 10:62857651-62857673 CCCTCTTCAGGTTCAGTGAGCAC 0: 1
1: 0
2: 2
3: 15
4: 132
Right 1068959985 10:62857702-62857724 AAATTAAGTACTTAGAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068959983 Original CRISPR GTGCTCACTGAACCTGAAGA GGG (reversed) Intronic
901892302 1:12277431-12277453 GTGTTTTCTCAACCTGAAGATGG + Exonic
903549886 1:24150571-24150593 GAGCTCAGGGAACCTGGAGAGGG - Intergenic
905344326 1:37301184-37301206 GTGCTATCAGAACGTGAAGAGGG - Intergenic
909156185 1:72079881-72079903 GAGATCACTGAACCAGAAAAAGG + Intronic
910939352 1:92516555-92516577 GTGCACACTGGATCTGATGAGGG + Intronic
911094540 1:94044810-94044832 GTTCTCACTGAACCTGGTGTGGG - Intronic
915455284 1:156036434-156036456 GTGCTGAATGAACCAGAATAGGG + Exonic
918030704 1:180806480-180806502 GTGACCAATGAACTTGAAGATGG + Exonic
919232177 1:194787906-194787928 GTGCTCCCGGAACCTAAACAGGG - Intergenic
921005478 1:211088958-211088980 ATGCTCATGAAACCTGAAGAGGG - Intronic
921071930 1:211667607-211667629 GTGGTCATTCAACCAGAAGAAGG - Intronic
921222729 1:212984938-212984960 GTGCTAAGTCAACCTGAGGAAGG - Intronic
921263163 1:213401521-213401543 ATTTTCACGGAACCTGAAGATGG + Intergenic
921691176 1:218152463-218152485 TTTCTCACAGAGCCTGAAGAAGG + Intergenic
923618454 1:235557345-235557367 GAGCTCACAGGACCAGAAGAAGG + Intronic
924157417 1:241193293-241193315 TTGCTCACTGCTCCTGAAGATGG + Intronic
1063558988 10:7108939-7108961 GAGCTCATGGCACCTGAAGAGGG - Intergenic
1065282188 10:24150849-24150871 TTGATCACTGGAACTGAAGAGGG + Intronic
1068959983 10:62857651-62857673 GTGCTCACTGAACCTGAAGAGGG - Intronic
1069765868 10:70858889-70858911 GTGCTAAGGGACCCTGAAGAGGG - Intronic
1070154864 10:73827136-73827158 GTGCCCACAAAACCTGCAGAGGG + Intronic
1073626016 10:105097846-105097868 GTGATAAGTGAACCTGAACATGG + Intronic
1075288824 10:121210631-121210653 GTTCTTACTGATCCTGAATATGG - Intergenic
1076759137 10:132591755-132591777 GAGCTCCCTGCACCTGCAGATGG - Intronic
1077221089 11:1416780-1416802 GGGCTCACTGAACCTCAAGCAGG - Intronic
1080798748 11:35589823-35589845 GTGCTCACTGAGACACAAGATGG + Intergenic
1081949406 11:47030311-47030333 GTTCTCACTCAAACTGAAAACGG - Intronic
1085064889 11:73485718-73485740 GTAATCAATCAACCTGAAGATGG + Intronic
1085309282 11:75506688-75506710 GTGTTCACGGAGCCTGCAGAGGG + Intronic
1086255687 11:84873727-84873749 TTGCTCAATGAACCTCAACACGG - Intronic
1090284915 11:125491476-125491498 GTGCTGCCTGAAACTGAAAATGG - Intronic
1095906892 12:47387877-47387899 GTGCTCTTTGAAGATGAAGAAGG + Intergenic
1096571461 12:52525737-52525759 GTGCTCACGGAACATGAAGATGG - Intergenic
1097170396 12:57109767-57109789 GTCCTCCCTGAACCTGGAAATGG - Intronic
1098630544 12:72716573-72716595 CTTCTCACTGAAACTGCAGAGGG - Intergenic
1099819434 12:87691623-87691645 GTGCTCAGTGAACCTAAAGATGG - Intergenic
1101860547 12:108478975-108478997 GTGCTCACGTAACCTCAAGTGGG - Intergenic
1104752203 12:131246828-131246850 GTGCTCACAGAAGTTGAAGCGGG + Intergenic
1107763146 13:43703264-43703286 GTACACACTGCACCTGAGGAAGG - Intronic
1120988623 14:90355473-90355495 GTGCTCACTGAGCTTGACAAAGG - Intergenic
1124137530 15:27048210-27048232 GTGCTCATTTACTCTGAAGAGGG + Intronic
1125362324 15:38877214-38877236 GTGCCCACAGCACCTGTAGAAGG + Intergenic
1128636234 15:69304188-69304210 GGGCTCCCTGCTCCTGAAGAGGG + Intronic
1129272125 15:74424589-74424611 GTGCTCAAAGGACCAGAAGAAGG + Intronic
1131183064 15:90253633-90253655 GTGCTCACCCACCCTGGAGAGGG - Intronic
1133667487 16:7983456-7983478 CTGCTCACTGAACCAGAGGCTGG - Intergenic
1136574022 16:31112614-31112636 GGGCTCAGTGAACCTGAATGGGG - Intronic
1138216911 16:55212548-55212570 GTACTAACTGAACCTGAGGAGGG - Intergenic
1139013480 16:62661934-62661956 GTGCTCACTGACCACTAAGAAGG - Intergenic
1139063427 16:63283929-63283951 GTGCTCACTCATCCCGAACAAGG - Intergenic
1140902611 16:79383766-79383788 GTGCTCATTAAACCTGCAGTTGG + Intergenic
1141380626 16:83573410-83573432 GTGACCACTGAACCTGTGGAAGG + Intronic
1141450398 16:84096139-84096161 GTTCTCACTGAACCAGAAGGGGG + Intronic
1141453351 16:84120351-84120373 CTGCTCACTGACCCAGAAGCTGG - Intergenic
1142171118 16:88623370-88623392 TTGCTCACTGCACCTGCTGAGGG - Intronic
1144575488 17:16427048-16427070 GTGCTCACTGTATGTGAAAAAGG + Intronic
1144751222 17:17649509-17649531 GTGCTCAAGGATCCTAAAGAGGG + Intergenic
1146445522 17:32929664-32929686 GAGCTCACTGGACCACAAGAAGG - Intronic
1146767818 17:35539883-35539905 GAGCTGACAGAACCTGCAGAAGG - Intergenic
1150583018 17:66492481-66492503 GTGTTCACTGAATGTGGAGATGG + Intronic
1151453923 17:74214986-74215008 GTGCCCACTGAACCCCAGGAAGG - Intronic
1153786872 18:8543417-8543439 GTGCACAGTGAAGCTGAGGATGG - Intergenic
1155541740 18:26875603-26875625 TTGCTCTCTGAAGCTAAAGATGG + Intergenic
925151554 2:1618733-1618755 GTGCTCACTGCACAGCAAGAAGG - Intergenic
925317399 2:2936737-2936759 GTGCACACTCAAGGTGAAGACGG + Intergenic
925317488 2:2937179-2937201 GTGCACACTGAAAGTGATGATGG + Intergenic
925931582 2:8712324-8712346 GTGCTCATGAAACCTGACGAAGG - Intergenic
927510174 2:23639399-23639421 TTGCCCCCTGAACCTGAGGAGGG - Intronic
929825890 2:45309553-45309575 GTCCTCGCGGCACCTGAAGAGGG - Intergenic
930281124 2:49371170-49371192 GTCCTCAGTGCTCCTGAAGATGG - Intergenic
930373429 2:50533719-50533741 GAGCTCACTGAACAAGAAGCGGG - Intronic
933193993 2:79368591-79368613 GGGCTCTCTGAACCTGGAAATGG + Intronic
933826231 2:86163574-86163596 GGGCTCATTGAACTTGAAGGAGG - Intronic
935036555 2:99381383-99381405 GTGCTCAGTGAACCAGAATGCGG + Intronic
942804959 2:179919618-179919640 GATGTCACTGAACGTGAAGATGG - Intergenic
943152041 2:184126065-184126087 ATACACAGTGAACCTGAAGAGGG - Intergenic
943953436 2:194158353-194158375 GGGGTCACTCAAACTGAAGATGG - Intergenic
946876720 2:224136883-224136905 GTGCTATTTGAACCTGTAGATGG - Intergenic
1171177667 20:23065564-23065586 GTGCACTCTGAAACTGAAGGAGG - Intergenic
1171838215 20:30176751-30176773 GTGCTGACTGAACGTGGAGAAGG + Intergenic
1172026474 20:31952157-31952179 GAGCTCTCTGAGCCTGCAGAGGG - Intergenic
1175951892 20:62587997-62588019 GTGCTCTCTGGACCTGCAGCTGG + Intergenic
1179059370 21:37965454-37965476 CAGCTCACTGCACCTGAAGGAGG - Intronic
1179636932 21:42718297-42718319 AAGCTCAATGAACATGAAGAAGG - Intronic
1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG + Intergenic
1184077890 22:42194954-42194976 GTGCTCACTGAACATAAGGTGGG + Intronic
1184317179 22:43703749-43703771 ATGCTCATTCAAGCTGAAGAAGG + Intronic
949930836 3:9077237-9077259 GTGCTCACTGAAGCAAAGGAGGG - Intronic
951930913 3:27966268-27966290 GTACTGACTGAAACTGAGGAGGG + Intergenic
953445587 3:42962374-42962396 GTGGAAACTGAACCTGGAGAAGG + Intronic
953495120 3:43379366-43379388 GTGAGCCCTGAACCTGAAAATGG + Intronic
953848706 3:46449185-46449207 GAGCTCTGTGGACCTGAAGAAGG - Intronic
953909368 3:46883887-46883909 GTGCTCACAGAAGCAGAGGATGG - Intronic
955202792 3:56866237-56866259 GTGCTGAATGGACCTGAAAATGG - Intronic
961240813 3:125409678-125409700 GTTCTCACAGAACCTGACTAGGG + Intergenic
963732191 3:148985317-148985339 GTGCTGAATGAACCAGAATAGGG + Intergenic
964174491 3:153809468-153809490 GTGCTCACTCATCCAGATGAAGG + Intergenic
968199240 3:196738320-196738342 TTTCACACTCAACCTGAAGAAGG - Intergenic
968791793 4:2669948-2669970 AAGCTCAGTGAACCTTAAGATGG - Intronic
969604900 4:8197597-8197619 GTGCTCACTGAGCATGTTGATGG + Intronic
970709075 4:18841077-18841099 GTGCTCAGAGACCCTGAAGTGGG - Intergenic
973973540 4:56239732-56239754 ATGCTCACTGACTCTGAAGATGG - Intronic
981300267 4:143178895-143178917 GGGGTCACTCAAACTGAAGATGG - Intergenic
981481867 4:145246869-145246891 GTCCTCACTGCACCTGGAGAAGG + Intergenic
983873730 4:172852007-172852029 GTATTCCCTGAACCTGAAGATGG - Intronic
985018585 4:185662838-185662860 GTGCTCAATGAGGCTGAAGTAGG - Intronic
988265512 5:28943828-28943850 GTACTCACTGAGCCTGAGAAAGG + Intergenic
988334987 5:29895481-29895503 TTGCTCACGTAATCTGAAGATGG - Intergenic
992615362 5:78541865-78541887 GTGCCCACCTAGCCTGAAGATGG + Intronic
997064454 5:130545264-130545286 GGGGTCACTCAAACTGAAGATGG - Intergenic
998657288 5:144195487-144195509 GTGAACACTGAAGCTCAAGATGG - Intronic
1001136598 5:169107692-169107714 GTTCTTACTGAAGCTGAAGTCGG - Intronic
1002192951 5:177488305-177488327 GTGGTCAGTCAACCTGAAGGGGG - Intronic
1002773494 6:308951-308973 GCGCTCACAGAACCTGGAGGAGG - Intronic
1002799829 6:511869-511891 GTGATCATTGATACTGAAGACGG - Intronic
1004605834 6:17194416-17194438 GTTCTAATTGAACCTGAGGAGGG + Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1016352391 6:143182427-143182449 GTGCTCAAGGAACCAGAAGGAGG - Intronic
1017310813 6:152975240-152975262 GGCCTCAGTGAACATGAAGAAGG - Exonic
1017398464 6:154030938-154030960 CTGCTCTCTGAACCTGCAAATGG + Intronic
1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG + Intergenic
1019146907 6:169981460-169981482 AAGCTCACTGAACCTGGAGGGGG + Intergenic
1024192505 7:47027213-47027235 GTGGGAACTGAACTTGAAGAAGG + Intergenic
1024237058 7:47406827-47406849 TTGCTCAGTGAACCTGCAGCAGG + Intronic
1024802566 7:53097999-53098021 GAGCTCCCTGAACTTGAAGATGG - Intergenic
1027582589 7:80017317-80017339 GAGCTCACTGAACTTCAGGATGG - Intergenic
1029859969 7:103560164-103560186 TGGATCACTGAACCTGAAAAAGG - Intronic
1030076449 7:105741081-105741103 GTTCTCACTGGTCCTGAGGAAGG - Intronic
1032386295 7:131527566-131527588 GTGCCCACTGAAACTGCACATGG - Intronic
1033241361 7:139682459-139682481 GTCCACACTGCACCTGAAGAAGG - Intronic
1033894576 7:146054903-146054925 GTGTCCACTCAAACTGAAGATGG - Intergenic
1034639049 7:152587606-152587628 GTGCTTCCTCAACCTGAAAAGGG - Intergenic
1034918064 7:155057161-155057183 GTGCTCACTGGGCCTGTAGCAGG - Intergenic
1035666251 8:1382289-1382311 GAGCCCACTCAACGTGAAGACGG - Intergenic
1036599756 8:10249524-10249546 GTGCTTAATGAACCTGAGGAAGG - Intronic
1039878274 8:41606155-41606177 CAGCACATTGAACCTGAAGAAGG + Intronic
1041826208 8:62099092-62099114 GTAGTCACTGAAGCTGAAGAGGG + Intergenic
1046420012 8:113968812-113968834 ATGCTCACTGAACCTAAGGTAGG - Intergenic
1049073732 8:140377182-140377204 TTGCTCACTAAACCCAAAGATGG - Intronic
1049462324 8:142735874-142735896 GTGCCCACTGCACCTGAATCAGG - Exonic
1051424487 9:16919696-16919718 AAGGTCACTGAACCTGAACAAGG + Intergenic
1057127635 9:92631576-92631598 CTGGTAATTGAACCTGAAGAGGG - Intronic
1057454318 9:95193809-95193831 GTGCTCACTGGAGCAAAAGAGGG + Intronic
1057598016 9:96433046-96433068 GTGCTCACTCAGCCTTAAGAGGG + Intergenic
1059764112 9:117367076-117367098 GTGCTCACTGAAAAAGAAGATGG - Intronic
1186423989 X:9449047-9449069 GAGCTCAGTGGACATGAAGAGGG - Intergenic
1187881794 X:23854017-23854039 GTTCTCAATGACTCTGAAGAAGG + Intronic
1189589859 X:42499234-42499256 GTCCTCACTGGAACTCAAGAAGG - Intergenic
1195413069 X:104589906-104589928 TTGCTCACTTACACTGAAGAAGG + Intronic
1198777344 X:140194304-140194326 GACCTCACTGAATGTGAAGACGG - Intergenic