ID: 1068961412

View in Genome Browser
Species Human (GRCh38)
Location 10:62870188-62870210
Sequence CTCACCAGTGATGCTATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068961412_1068961413 -8 Left 1068961412 10:62870188-62870210 CCAACAATAGCATCACTGGTGAG 0: 1
1: 0
2: 1
3: 15
4: 147
Right 1068961413 10:62870203-62870225 CTGGTGAGTCTGTAGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068961412 Original CRISPR CTCACCAGTGATGCTATTGT TGG (reversed) Intronic
908105718 1:60839723-60839745 TTCCCCATTGTTGCTATTGTTGG - Intergenic
908759008 1:67494913-67494935 GTCACCTGTGTTGCTAGTGTAGG + Intergenic
910447933 1:87317755-87317777 CTCAGCTTTGATGCTATTCTTGG + Intergenic
910710782 1:90177910-90177932 CTTACCAGTGTTGCTTTTATTGG - Intergenic
915669633 1:157477785-157477807 CTCACTGGTGGTGCTGTTGTGGG - Intergenic
915808406 1:158879121-158879143 CTCAGCGGTCATGATATTGTTGG + Intergenic
916940871 1:169676359-169676381 CTCACCTGTGGTGCTGTTCTAGG - Intronic
918527816 1:185484221-185484243 CTAACCAGTGCTTCTCTTGTGGG + Intergenic
920047293 1:203141505-203141527 CTCACCAGTGATTCTCTTGGGGG + Intronic
921997187 1:221433400-221433422 ATCACCATAGATGCTATGGTAGG + Intergenic
923007249 1:230060444-230060466 CTCATAAGTGATGCTAGTTTTGG + Intronic
923754918 1:236783433-236783455 CTCACCACTTAGGCAATTGTTGG + Intergenic
1066447402 10:35496312-35496334 CACACCAGTGATGTTCTTGTTGG + Intronic
1067025420 10:42839502-42839524 CTCACCAGTGATGTGACTCTGGG + Intergenic
1067378231 10:45748014-45748036 CACCCCAGTGATGAGATTGTAGG - Intronic
1067885932 10:50088689-50088711 CACCCCAGTGATGAGATTGTAGG - Intronic
1068153917 10:53170701-53170723 CTCATCAGAGATGCGATTGGAGG + Intergenic
1068614027 10:59091877-59091899 TTTACCAGTGCTGTTATTGTTGG + Intergenic
1068629152 10:59282150-59282172 CTCACCAGCAATGCTATACTAGG + Intronic
1068961412 10:62870188-62870210 CTCACCAGTGATGCTATTGTTGG - Intronic
1069249354 10:66247725-66247747 TTCACCAGTAATACTATTGTAGG - Intronic
1069481811 10:68789746-68789768 TTCACCAGAGAGGCTTTTGTTGG - Exonic
1074314999 10:112353131-112353153 CCAACCAGTGATGCTAATGTGGG - Intergenic
1074566479 10:114583600-114583622 ATCCCCAGTGATGGTATTGCTGG - Intronic
1074857391 10:117483536-117483558 CACAACACTGATGGTATTGTGGG - Intergenic
1076516584 10:131048578-131048600 CTCACCAGTGATGCTCCTTCAGG - Intergenic
1077708593 11:4513161-4513183 CTCAGCACTGGTGCTACTGTTGG + Intergenic
1080616752 11:33951116-33951138 TTCAGCAGTGAAGTTATTGTAGG - Intergenic
1083167630 11:60900849-60900871 CTCACCAGTGAGGATCTTGTTGG + Exonic
1084633138 11:70369573-70369595 TTCACCAGTGAAGCTATCTTGGG + Intronic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1085745111 11:79108610-79108632 CTCATCGGTGATGCTAATTTTGG - Intronic
1089961768 11:122623057-122623079 CTCACCACTGATGGGAGTGTTGG - Intergenic
1090318087 11:125815466-125815488 CTCACCAGATATACTATTCTAGG + Intergenic
1091456300 12:610546-610568 CCCACCAGTGAAGCTGTGGTGGG - Intronic
1094464642 12:30739034-30739056 ATAACCAGTGATGGGATTGTTGG - Intronic
1094626715 12:32131429-32131451 CTGACCAGTAAAGCTATGGTAGG - Intronic
1097107822 12:56635590-56635612 CTCACCAGGGCTGCTATTGATGG - Intronic
1100967936 12:100033405-100033427 CTCACCAGGAATTCTTTTGTGGG - Intronic
1103940290 12:124497813-124497835 GTCACCAGTGACGCTATGATGGG + Intronic
1107557872 13:41533636-41533658 CTCAGCAGTGATGATAGAGTAGG - Intergenic
1107818841 13:44267968-44267990 CTCACCTGTGATGATCTTTTGGG + Intergenic
1108492207 13:50992882-50992904 CTCACCAGTGGTGCCATCTTGGG + Intergenic
1108787829 13:53927310-53927332 ATCACCAGTAATGAGATTGTTGG + Intergenic
1110603936 13:77409508-77409530 CTCACCAGTGAAGCAAATGCTGG - Intergenic
1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG + Intergenic
1117110533 14:52448417-52448439 TTCACCAGTTATACTATTCTAGG - Intronic
1120028411 14:79612044-79612066 CTGAACTGTGATGCTATTATTGG + Intronic
1121445502 14:93976127-93976149 CTTATCAATGATGCTATTGTTGG - Intronic
1121741580 14:96256153-96256175 CGCTCCAGTGATGTCATTGTGGG - Exonic
1122832445 14:104406100-104406122 CTCACCACTGATTCTGTTCTTGG - Intergenic
1123107125 14:105846882-105846904 CTCACCAGTGGTGCTGTAGAGGG - Intergenic
1123426049 15:20170956-20170978 CTCACCAGTGATGTGACTCTGGG + Intergenic
1123535281 15:21177480-21177502 CTCACCAGTGATGTGACTCTGGG + Intergenic
1124987817 15:34639322-34639344 CACACCAGAGATGCTACTGGAGG + Intergenic
1126294802 15:47128019-47128041 TTCACCAGATATGCTATTCTAGG + Intergenic
1127022485 15:54763953-54763975 TTCACCAGATATGCTATTCTAGG - Intergenic
1128388261 15:67165578-67165600 CTCACTAGTGATGCTTTTCTTGG + Intronic
1134237988 16:12482771-12482793 ATCACCAATGATGGCATTGTAGG - Intronic
1136858205 16:33678562-33678584 CTCACCAGTGATGTGACTCTGGG - Intergenic
1137271609 16:46906046-46906068 CTGGCCAGTGGTGCTAATGTGGG + Intronic
1139089102 16:63622082-63622104 CTCACCAGTGATAATAATGATGG + Intergenic
1203119771 16_KI270728v1_random:1527031-1527053 CTCACCAGTGATGTGACTCTGGG - Intergenic
1145759661 17:27419013-27419035 CTCACCAGTGAAGCCACTTTAGG - Intergenic
1146159633 17:30552965-30552987 CTCACCAGTGAAGCCACTTTAGG - Intergenic
1147987414 17:44314658-44314680 CCCCCCAGAGCTGCTATTGTTGG - Intronic
1148441921 17:47715937-47715959 CCCTCCAGAGATGCTATTTTAGG + Intergenic
1152983604 18:302361-302383 CTGACCAGTGGTGCTATTTTTGG + Intergenic
1154946332 18:21165459-21165481 CCCACCAGTGATTTTATTTTTGG + Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1163496062 19:17647260-17647282 CTCACCGGTGATGCTGATCTTGG + Exonic
926949008 2:18220988-18221010 CACATCAGAGATGCTATTTTGGG + Intronic
929520351 2:42644483-42644505 CCCAAAAGTGATGCTATTATAGG + Intronic
932777329 2:74536062-74536084 CTCAGCTGTGATGTTCTTGTGGG + Exonic
933235924 2:79864332-79864354 AACACCAGTGATTCTATTGTTGG + Intronic
933675620 2:85054103-85054125 CACACCAGTAAAGCTACTGTTGG + Exonic
937238841 2:120447346-120447368 CTCACCAGGGATGCTGTCATAGG + Intergenic
937466526 2:122137788-122137810 CTCCCCAGTGATGCTGATCTGGG - Intergenic
939483202 2:142776145-142776167 TTCACCAGATATGCTATTTTAGG + Intergenic
940298550 2:152155375-152155397 CTCAGCAGTGAAGCTTTGGTTGG - Intronic
942973634 2:181987854-181987876 ATCACAAGTGATGCTGGTGTAGG - Exonic
944993649 2:205268881-205268903 CTTACCAGTGATGTTATTTGCGG + Intronic
946328140 2:218995393-218995415 CTCCTCAGTGATGCTGTTCTAGG + Intergenic
947210253 2:227701852-227701874 CCTGCCAGTGATGCTATTTTAGG + Intronic
1171440884 20:25161996-25162018 AGCTCCAGTGATGCTTTTGTTGG + Intergenic
1171881136 20:30617973-30617995 CTCATCAGTGAGGCCCTTGTCGG - Intergenic
1174579908 20:51564039-51564061 CTGCCCAGTGAGGCTATTGTGGG - Intergenic
1175387219 20:58604917-58604939 CTCACCTGTGTTTCTAATGTGGG + Intergenic
1176365859 21:6032408-6032430 CTCCCCAGTGGTGCTTTTCTGGG + Intergenic
1179011015 21:37556332-37556354 CTTACCTGTGGTGCCATTGTTGG - Intergenic
1179757657 21:43506137-43506159 CTCCCCAGTGGTGCTTTTCTGGG - Intergenic
1179947978 21:44691748-44691770 TTCACCAGTAAAGCTGTTGTTGG - Intronic
949473968 3:4424895-4424917 CTCAGCACTGCTGCTATTTTAGG + Intronic
950572989 3:13813556-13813578 CTTAGCACTGATGCTATGGTGGG - Intergenic
951701524 3:25502083-25502105 GTGCCCAGTGATGCTCTTGTGGG + Intronic
953611043 3:44447526-44447548 CTTACCAGTGTAGCGATTGTGGG - Exonic
953687138 3:45086863-45086885 CTGACCAGTGATGCAAATGGAGG + Intronic
957881051 3:86213365-86213387 CTAACCATTGGAGCTATTGTTGG + Intergenic
957928123 3:86841539-86841561 CTCACTACTGATGCTATTAACGG + Intergenic
958135259 3:89480533-89480555 CTCTCCAGTGGAGCTATTCTCGG - Exonic
958185575 3:90115318-90115340 CTCACGAATGGTGTTATTGTGGG + Intergenic
958976788 3:100677683-100677705 TTCACCAGATATGCTATTTTAGG + Intronic
960202845 3:114858852-114858874 CACAACAGTGATGTTATGGTGGG - Intronic
960214299 3:115011536-115011558 TTCACCAGATATGCTATTCTAGG - Intronic
963763116 3:149305794-149305816 TTCACCAGATATGCTATTCTAGG + Intergenic
964312909 3:155413453-155413475 CTTCCAAGTGATGCCATTGTAGG - Intronic
967020409 3:185517513-185517535 TTCAAGAGTGATGCTATTTTAGG - Intronic
970175750 4:13337921-13337943 CTCACCAGTGATGTAATAGATGG - Intergenic
970460351 4:16268899-16268921 CTCACCAGTGATGCTGCCTTAGG - Intergenic
976693428 4:87893285-87893307 CTCACCAGTGATGTAATAGGTGG - Intergenic
978476007 4:109131153-109131175 CTCATCAGTAATGTTTTTGTTGG + Intronic
981759145 4:148174341-148174363 CTGAGCGATGATGCTATTGTTGG - Intronic
983588279 4:169379631-169379653 CTCAGCAGTGAAGCCATTTTAGG - Intergenic
984689892 4:182714844-182714866 CTCTCCAGTGATGGAATAGTTGG + Intronic
989352569 5:40502957-40502979 CTGCCCAGTGTTGCTATTTTGGG + Intergenic
990048751 5:51468688-51468710 CTCACCAGTGATGTTCTTTTTGG - Intergenic
990423060 5:55656710-55656732 CTTACCAGGGTTGCTATTATTGG + Exonic
992569624 5:78042057-78042079 CTCACCAGTGATGCTATAGATGG + Intronic
995146655 5:108794645-108794667 TTCACCAGATATGCTATTCTAGG + Intronic
995777777 5:115744189-115744211 TTCACCAGTTATACTATTCTAGG + Intergenic
996459733 5:123727226-123727248 TTCACCAGATATGCTATTCTAGG - Intergenic
998252586 5:140562760-140562782 CTCACCAGTGTCCCTACTGTAGG - Intronic
999406387 5:151310630-151310652 TTCACCAGATATACTATTGTAGG + Intergenic
999458717 5:151739648-151739670 CTCTCCAGTCATGGTAATGTGGG + Intergenic
1002916794 6:1535660-1535682 CTCACCAATGATGCCATCTTAGG + Intergenic
1003262977 6:4539835-4539857 TTCACCAGTGAAGCCATTTTGGG - Intergenic
1004286018 6:14321781-14321803 CTCACCAGAGATGCTATGATGGG - Intergenic
1006646854 6:35520887-35520909 CTGACAAGTGATGCTACTGGGGG + Intergenic
1007918142 6:45580365-45580387 CTCACCAGTGTTGAGATTATAGG + Intronic
1010654660 6:78497795-78497817 CTCACCAGTGATGCACATCTAGG + Intergenic
1011072797 6:83404014-83404036 ATAACCAGTAATGGTATTGTGGG + Intronic
1012892315 6:104910106-104910128 TTCACCAGATATGCTATTCTAGG - Intergenic
1014292430 6:119574696-119574718 TTCACCAGTGAAACTATTTTTGG - Intergenic
1015155729 6:130093783-130093805 CTGACCACTGATGTTAGTGTGGG - Intronic
1018542401 6:164896517-164896539 GTCACCAATGATGCTCATGTTGG + Intergenic
1021687050 7:23196890-23196912 CTCTTAAGTGATGCTATTTTGGG - Intronic
1022849087 7:34241500-34241522 CTTACAAGTGATGCTATTCCTGG - Intergenic
1024135390 7:46402144-46402166 ATCCCCAGTAATGCGATTGTTGG - Intergenic
1024218909 7:47272538-47272560 CACACCAGTGATACAAATGTTGG + Intergenic
1026440411 7:70438850-70438872 CCCACCAGGGATGCTGTTGGAGG + Intronic
1028279158 7:88898783-88898805 CTCTGCAGTGATGCTATTACTGG + Intronic
1029722820 7:102381092-102381114 CTCACCGGTGTTGCTTTTGGTGG + Intronic
1029967740 7:104757833-104757855 CTAACCAGTAATGGAATTGTTGG - Intronic
1033586542 7:142778824-142778846 CTCATCAGTGATGCTCTGGATGG - Intergenic
1041756007 8:61313749-61313771 CTCAACAGGAATGCTGTTGTTGG - Intronic
1042559332 8:70061204-70061226 CTCTGCAGGGATGCTTTTGTAGG - Intronic
1043627553 8:82281310-82281332 CTATTCACTGATGCTATTGTTGG - Intergenic
1046348787 8:112976111-112976133 CTCACCAGTGGAGGTAGTGTGGG + Exonic
1050249228 9:3726694-3726716 CTTGCCAGTCATGCTATTTTGGG - Intergenic
1050651314 9:7779868-7779890 CTCAACAGTTATGATAGTGTTGG + Intergenic
1051940297 9:22496936-22496958 ATCATCAGTGTTGCTATTGTTGG - Intergenic
1061928807 9:133821707-133821729 CTCAGCTGTGTTGCTTTTGTGGG + Intronic
1187128279 X:16475023-16475045 CTCACCAGTGATGTAATAGATGG + Intergenic
1190594538 X:52039429-52039451 TTCACCAGAAATGCTATTCTGGG - Intergenic
1190790690 X:53697188-53697210 CTCACCAATGAAGCCACTGTGGG - Intergenic
1196625547 X:117873215-117873237 TTCACCAGCTATACTATTGTAGG - Intergenic
1197010260 X:121552461-121552483 TTCACCAGATATGCTATTGTAGG - Intergenic
1197071510 X:122303785-122303807 CTCACCATTAAGGCTAATGTTGG + Intergenic
1198817881 X:140612598-140612620 TTCACCAGAGATACTATTCTAGG + Intergenic
1198996030 X:142575515-142575537 TTCACCAGATATGCTATTCTAGG + Intergenic
1202035585 Y:20631514-20631536 TTCACCAGTTATACTATTCTAGG + Intergenic
1202177630 Y:22112352-22112374 CTGTCCAGTGGTGCTATTGAGGG + Intergenic
1202193294 Y:22267856-22267878 CTCATCACTGATGCTATATTTGG - Intergenic
1202213731 Y:22474043-22474065 CTGTCCAGTGGTGCTATTGAGGG - Intergenic