ID: 1068961596

View in Genome Browser
Species Human (GRCh38)
Location 10:62872056-62872078
Sequence AGCTTCAACCTGGGCATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068961591_1068961596 -10 Left 1068961591 10:62872043-62872065 CCCAGCTACTCGAAGCTTCAACC 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1068961596 10:62872056-62872078 AGCTTCAACCTGGGCATTGGAGG No data
1068961590_1068961596 -2 Left 1068961590 10:62872035-62872057 CCTGTAATCCCAGCTACTCGAAG 0: 19
1: 686
2: 7693
3: 72028
4: 242933
Right 1068961596 10:62872056-62872078 AGCTTCAACCTGGGCATTGGAGG No data
1068961589_1068961596 17 Left 1068961589 10:62872016-62872038 CCAGGTGTGGTGGTGGGCGCCTG 0: 1653
1: 12179
2: 38867
3: 74712
4: 98800
Right 1068961596 10:62872056-62872078 AGCTTCAACCTGGGCATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068961596 Original CRISPR AGCTTCAACCTGGGCATTGG AGG Intronic
No off target data available for this crispr