ID: 1068965820

View in Genome Browser
Species Human (GRCh38)
Location 10:62911329-62911351
Sequence TAGAGTGAGTGAAGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068965820_1068965823 21 Left 1068965820 10:62911329-62911351 CCCTGCTTCCTTCACTCACTCTA No data
Right 1068965823 10:62911373-62911395 GCAAAAATGCTTGCAACCCCAGG No data
1068965820_1068965824 22 Left 1068965820 10:62911329-62911351 CCCTGCTTCCTTCACTCACTCTA No data
Right 1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG No data
1068965820_1068965825 23 Left 1068965820 10:62911329-62911351 CCCTGCTTCCTTCACTCACTCTA No data
Right 1068965825 10:62911375-62911397 AAAAATGCTTGCAACCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068965820 Original CRISPR TAGAGTGAGTGAAGGAAGCA GGG (reversed) Intronic