ID: 1068965821 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:62911330-62911352 |
| Sequence | GTAGAGTGAGTGAAGGAAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068965821_1068965824 | 21 | Left | 1068965821 | 10:62911330-62911352 | CCTGCTTCCTTCACTCACTCTAC | No data | ||
| Right | 1068965824 | 10:62911374-62911396 | CAAAAATGCTTGCAACCCCAGGG | No data | ||||
| 1068965821_1068965825 | 22 | Left | 1068965821 | 10:62911330-62911352 | CCTGCTTCCTTCACTCACTCTAC | No data | ||
| Right | 1068965825 | 10:62911375-62911397 | AAAAATGCTTGCAACCCCAGGGG | No data | ||||
| 1068965821_1068965823 | 20 | Left | 1068965821 | 10:62911330-62911352 | CCTGCTTCCTTCACTCACTCTAC | No data | ||
| Right | 1068965823 | 10:62911373-62911395 | GCAAAAATGCTTGCAACCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068965821 | Original CRISPR | GTAGAGTGAGTGAAGGAAGC AGG (reversed) | Intronic | ||