ID: 1068965822

View in Genome Browser
Species Human (GRCh38)
Location 10:62911337-62911359
Sequence TAGTTCTGTAGAGTGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068965822_1068965826 25 Left 1068965822 10:62911337-62911359 CCTTCACTCACTCTACAGAACTA No data
Right 1068965826 10:62911385-62911407 GCAACCCCAGGGGAGATGAGAGG No data
1068965822_1068965825 15 Left 1068965822 10:62911337-62911359 CCTTCACTCACTCTACAGAACTA No data
Right 1068965825 10:62911375-62911397 AAAAATGCTTGCAACCCCAGGGG No data
1068965822_1068965823 13 Left 1068965822 10:62911337-62911359 CCTTCACTCACTCTACAGAACTA No data
Right 1068965823 10:62911373-62911395 GCAAAAATGCTTGCAACCCCAGG No data
1068965822_1068965824 14 Left 1068965822 10:62911337-62911359 CCTTCACTCACTCTACAGAACTA No data
Right 1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068965822 Original CRISPR TAGTTCTGTAGAGTGAGTGA AGG (reversed) Intronic