ID: 1068965823

View in Genome Browser
Species Human (GRCh38)
Location 10:62911373-62911395
Sequence GCAAAAATGCTTGCAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068965820_1068965823 21 Left 1068965820 10:62911329-62911351 CCCTGCTTCCTTCACTCACTCTA No data
Right 1068965823 10:62911373-62911395 GCAAAAATGCTTGCAACCCCAGG No data
1068965821_1068965823 20 Left 1068965821 10:62911330-62911352 CCTGCTTCCTTCACTCACTCTAC No data
Right 1068965823 10:62911373-62911395 GCAAAAATGCTTGCAACCCCAGG No data
1068965819_1068965823 26 Left 1068965819 10:62911324-62911346 CCTTTCCCTGCTTCCTTCACTCA No data
Right 1068965823 10:62911373-62911395 GCAAAAATGCTTGCAACCCCAGG No data
1068965822_1068965823 13 Left 1068965822 10:62911337-62911359 CCTTCACTCACTCTACAGAACTA No data
Right 1068965823 10:62911373-62911395 GCAAAAATGCTTGCAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068965823 Original CRISPR GCAAAAATGCTTGCAACCCC AGG Intronic