ID: 1068965824

View in Genome Browser
Species Human (GRCh38)
Location 10:62911374-62911396
Sequence CAAAAATGCTTGCAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068965822_1068965824 14 Left 1068965822 10:62911337-62911359 CCTTCACTCACTCTACAGAACTA 0: 1
1: 0
2: 0
3: 19
4: 215
Right 1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG No data
1068965821_1068965824 21 Left 1068965821 10:62911330-62911352 CCTGCTTCCTTCACTCACTCTAC 0: 1
1: 0
2: 3
3: 43
4: 416
Right 1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG No data
1068965820_1068965824 22 Left 1068965820 10:62911329-62911351 CCCTGCTTCCTTCACTCACTCTA 0: 1
1: 0
2: 0
3: 49
4: 1126
Right 1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG No data
1068965819_1068965824 27 Left 1068965819 10:62911324-62911346 CCTTTCCCTGCTTCCTTCACTCA 0: 1
1: 0
2: 9
3: 138
4: 1635
Right 1068965824 10:62911374-62911396 CAAAAATGCTTGCAACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068965824 Original CRISPR CAAAAATGCTTGCAACCCCA GGG Intronic
No off target data available for this crispr