ID: 1068983793

View in Genome Browser
Species Human (GRCh38)
Location 10:63088547-63088569
Sequence GCACCTCCATGGAGCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068983786_1068983793 19 Left 1068983786 10:63088505-63088527 CCACCTTCAGCTGTCCTCTGGAA No data
Right 1068983793 10:63088547-63088569 GCACCTCCATGGAGCACTGAGGG No data
1068983784_1068983793 28 Left 1068983784 10:63088496-63088518 CCAGCATCTCCACCTTCAGCTGT No data
Right 1068983793 10:63088547-63088569 GCACCTCCATGGAGCACTGAGGG No data
1068983787_1068983793 16 Left 1068983787 10:63088508-63088530 CCTTCAGCTGTCCTCTGGAATGA No data
Right 1068983793 10:63088547-63088569 GCACCTCCATGGAGCACTGAGGG No data
1068983789_1068983793 5 Left 1068983789 10:63088519-63088541 CCTCTGGAATGATCAGGAAGATT No data
Right 1068983793 10:63088547-63088569 GCACCTCCATGGAGCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068983793 Original CRISPR GCACCTCCATGGAGCACTGA GGG Intergenic