ID: 1068984409

View in Genome Browser
Species Human (GRCh38)
Location 10:63094035-63094057
Sequence CATTTAGTGACAGAGTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068984409_1068984417 27 Left 1068984409 10:63094035-63094057 CCTTTCCACTCTGTCACTAAATG No data
Right 1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068984409 Original CRISPR CATTTAGTGACAGAGTGGAA AGG (reversed) Intergenic
No off target data available for this crispr