ID: 1068984410

View in Genome Browser
Species Human (GRCh38)
Location 10:63094040-63094062
Sequence ACTGGCATTTAGTGACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068984410_1068984418 26 Left 1068984410 10:63094040-63094062 CCACTCTGTCACTAAATGCCAGT No data
Right 1068984418 10:63094089-63094111 AAAATGTCCCCAAACATGGCTGG No data
1068984410_1068984417 22 Left 1068984410 10:63094040-63094062 CCACTCTGTCACTAAATGCCAGT No data
Right 1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068984410 Original CRISPR ACTGGCATTTAGTGACAGAG TGG (reversed) Intergenic
No off target data available for this crispr