ID: 1068984413

View in Genome Browser
Species Human (GRCh38)
Location 10:63094068-63094090
Sequence TTTGTTGGTCACAATAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068984413_1068984417 -6 Left 1068984413 10:63094068-63094090 CCCCAATTATTGTGACCAACAAA No data
Right 1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG No data
1068984413_1068984418 -2 Left 1068984413 10:63094068-63094090 CCCCAATTATTGTGACCAACAAA No data
Right 1068984418 10:63094089-63094111 AAAATGTCCCCAAACATGGCTGG No data
1068984413_1068984422 7 Left 1068984413 10:63094068-63094090 CCCCAATTATTGTGACCAACAAA No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068984413 Original CRISPR TTTGTTGGTCACAATAATTG GGG (reversed) Intergenic
No off target data available for this crispr