ID: 1068984422

View in Genome Browser
Species Human (GRCh38)
Location 10:63094098-63094120
Sequence CCAAACATGGCTGGACGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068984415_1068984422 5 Left 1068984415 10:63094070-63094092 CCAATTATTGTGACCAACAAAAA No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data
1068984414_1068984422 6 Left 1068984414 10:63094069-63094091 CCCAATTATTGTGACCAACAAAA No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data
1068984416_1068984422 -8 Left 1068984416 10:63094083-63094105 CCAACAAAAATGTCCCCAAACAT No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data
1068984411_1068984422 17 Left 1068984411 10:63094058-63094080 CCAGTAGCACCCCCAATTATTGT No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data
1068984412_1068984422 8 Left 1068984412 10:63094067-63094089 CCCCCAATTATTGTGACCAACAA No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data
1068984413_1068984422 7 Left 1068984413 10:63094068-63094090 CCCCAATTATTGTGACCAACAAA No data
Right 1068984422 10:63094098-63094120 CCAAACATGGCTGGACGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068984422 Original CRISPR CCAAACATGGCTGGACGCAG TGG Intergenic
No off target data available for this crispr