ID: 1068988851

View in Genome Browser
Species Human (GRCh38)
Location 10:63131015-63131037
Sequence CAGCAAACAGCGGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068988844_1068988851 13 Left 1068988844 10:63130979-63131001 CCAGAGGGGTGGAAGTCAGCGGC 0: 21
1: 71
2: 115
3: 97
4: 145
Right 1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG No data
1068988842_1068988851 23 Left 1068988842 10:63130969-63130991 CCTGATGGATCCAGAGGGGTGGA No data
Right 1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG No data
1068988840_1068988851 24 Left 1068988840 10:63130968-63130990 CCCTGATGGATCCAGAGGGGTGG No data
Right 1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068988851 Original CRISPR CAGCAAACAGCGGTGGTGGA CGG Intergenic
No off target data available for this crispr