ID: 1068990297

View in Genome Browser
Species Human (GRCh38)
Location 10:63143232-63143254
Sequence CAAAAATAGAAGTGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068990292_1068990297 29 Left 1068990292 10:63143180-63143202 CCTGTAATTGAAAGGCACGAATC 0: 1
1: 0
2: 0
3: 0
4: 52
Right 1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068990297 Original CRISPR CAAAAATAGAAGTGGGGAAA AGG Intronic
No off target data available for this crispr