ID: 1069009922

View in Genome Browser
Species Human (GRCh38)
Location 10:63361173-63361195
Sequence GGCACTTTGGGAGGACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069009915_1069009922 7 Left 1069009915 10:63361143-63361165 CCAGGTGCAGTATCTCACATCTG 0: 1
1: 29
2: 826
3: 8454
4: 30219
Right 1069009922 10:63361173-63361195 GGCACTTTGGGAGGACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069009922 Original CRISPR GGCACTTTGGGAGGACAAGC TGG Intronic
No off target data available for this crispr