ID: 1069022360

View in Genome Browser
Species Human (GRCh38)
Location 10:63503239-63503261
Sequence AAAAACCTACAATTTTAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069022360_1069022369 -5 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022369 10:63503257-63503279 TTTTTTAGGGGTTTTTGGGGGGG No data
1069022360_1069022366 -8 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022366 10:63503254-63503276 AGGTTTTTTAGGGGTTTTTGGGG No data
1069022360_1069022367 -7 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022367 10:63503255-63503277 GGTTTTTTAGGGGTTTTTGGGGG No data
1069022360_1069022364 -10 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022364 10:63503252-63503274 GTAGGTTTTTTAGGGGTTTTTGG No data
1069022360_1069022365 -9 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022365 10:63503253-63503275 TAGGTTTTTTAGGGGTTTTTGGG No data
1069022360_1069022370 13 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022370 10:63503275-63503297 GGGGGCTTTTAGTTCAACTTAGG No data
1069022360_1069022368 -6 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069022360 Original CRISPR AAAAACCTACAATTTTAGTT AGG (reversed) Intergenic
No off target data available for this crispr