ID: 1069022368 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:63503256-63503278 |
Sequence | GTTTTTTAGGGGTTTTTGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069022360_1069022368 | -6 | Left | 1069022360 | 10:63503239-63503261 | CCTAACTAAAATTGTAGGTTTTT | No data | ||
Right | 1069022368 | 10:63503256-63503278 | GTTTTTTAGGGGTTTTTGGGGGG | No data | ||||
1069022359_1069022368 | -5 | Left | 1069022359 | 10:63503238-63503260 | CCCTAACTAAAATTGTAGGTTTT | No data | ||
Right | 1069022368 | 10:63503256-63503278 | GTTTTTTAGGGGTTTTTGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069022368 | Original CRISPR | GTTTTTTAGGGGTTTTTGGG GGG | Intergenic | ||
No off target data available for this crispr |