ID: 1069022368

View in Genome Browser
Species Human (GRCh38)
Location 10:63503256-63503278
Sequence GTTTTTTAGGGGTTTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069022360_1069022368 -6 Left 1069022360 10:63503239-63503261 CCTAACTAAAATTGTAGGTTTTT No data
Right 1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG No data
1069022359_1069022368 -5 Left 1069022359 10:63503238-63503260 CCCTAACTAAAATTGTAGGTTTT No data
Right 1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069022368 Original CRISPR GTTTTTTAGGGGTTTTTGGG GGG Intergenic
No off target data available for this crispr