ID: 1069024665

View in Genome Browser
Species Human (GRCh38)
Location 10:63525933-63525955
Sequence TGTATTTAATCCCATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069024665_1069024669 11 Left 1069024665 10:63525933-63525955 CCTACCCCATGGGATTAAATACA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1069024669 10:63525967-63525989 AATGTCCATAGTCCAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069024665 Original CRISPR TGTATTTAATCCCATGGGGT AGG (reversed) Intronic
904083090 1:27884370-27884392 CGTATTTAATCACGTGTGGTAGG + Intronic
906227299 1:44132504-44132526 TGTATTTAATAGGCTGGGGTGGG - Intronic
907877196 1:58502837-58502859 TGAATTTAATCACTTGGGGTGGG + Intronic
907977306 1:59444500-59444522 GGTATAGAACCCCATGGGGTTGG - Intronic
908865907 1:68548264-68548286 TCTAATTTCTCCCATGGGGTGGG + Intergenic
911676100 1:100659918-100659940 TGAATTTAATCCAATGGGTGAGG + Intergenic
919131793 1:193460297-193460319 TTGATTTAATCCTATGAGGTAGG + Intergenic
921266125 1:213421900-213421922 TAAATTCAATCCCATGAGGTTGG - Intergenic
921316273 1:213894256-213894278 TGTAGTGAAGCCCATGGGGAAGG - Intergenic
921365561 1:214370401-214370423 TGGATTTCATCCCATGGGCACGG + Intronic
923896318 1:238274275-238274297 TGGTTTTCATCCCATCGGGTAGG + Intergenic
1063181656 10:3606857-3606879 TTTGTTTAATTCCATGTGGTTGG + Intergenic
1064862146 10:19838419-19838441 TGTATTTATTATCATGGGCTAGG - Intronic
1065037504 10:21654796-21654818 TATATTTAAACCCAGTGGGTAGG + Intronic
1068583203 10:58766257-58766279 TGGATATAGTGCCATGGGGTGGG + Intronic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1072822059 10:98567933-98567955 TGATTTTTATCCCATGAGGTGGG - Intronic
1072964386 10:99958615-99958637 TGTATCTACTACCATGGGCTTGG + Intronic
1077661421 11:4071898-4071920 TGGATTTATTTCCATGGGCTGGG + Intronic
1077811749 11:5644887-5644909 TGTATTCATTACCATGGGGATGG - Intronic
1078705102 11:13736005-13736027 TGTTTTTAATGTAATGGGGTAGG - Intergenic
1079006806 11:16797292-16797314 TTTATTTTAGTCCATGGGGTGGG - Intronic
1082128273 11:48456959-48456981 TGTAGGGAAACCCATGGGGTTGG - Intergenic
1082188416 11:49211824-49211846 TGTATTTATTCCCAGGGCTTTGG - Intergenic
1082561823 11:54627884-54627906 TGTAGGGAAACCCATGGGGTTGG - Intergenic
1084652980 11:70499892-70499914 TTTAATTAATCCCTTGGAGTTGG - Intronic
1085032835 11:73283118-73283140 TGGATCTAATTCCATGGGCTGGG + Intronic
1086678106 11:89634879-89634901 TGTATTTATTCCCAGGGCTTTGG + Intergenic
1093911427 12:24751938-24751960 GGTATTTAAACCCATGGGAATGG - Intergenic
1095846549 12:46751805-46751827 TGTATTTATTTCCTTGGGCTTGG + Intergenic
1098153928 12:67577382-67577404 GGTATTTAAAACTATGGGGTTGG - Intergenic
1099182584 12:79485222-79485244 TTTATTTAACCCAATGAGGTAGG - Intergenic
1099199171 12:79655497-79655519 AGTATTTAATCCTTTGGTGTAGG - Intronic
1100321207 12:93494699-93494721 GGTATTTAATGCCATGGGACTGG + Intronic
1103214471 12:119190932-119190954 TGTATTTAAACCCATTTGGTGGG - Intronic
1104177548 12:126347756-126347778 TGTATTTTGTCCCATGCTGTGGG + Intergenic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1110358024 13:74590970-74590992 TGTATATAATCCAATGAGTTTGG + Intergenic
1117929476 14:60824950-60824972 TGGAATTGATCCAATGGGGTGGG - Intronic
1118562174 14:67097808-67097830 TGTATTTCTTCCCATGGGTGTGG - Intronic
1120579344 14:86227115-86227137 TGTATTTACAACCATGGGGAAGG - Intergenic
1121215076 14:92241543-92241565 TGTCTGGAATACCATGGGGTAGG - Intergenic
1121713450 14:96056000-96056022 TTTCTTAAATCCCAGGGGGTGGG - Intronic
1122472026 14:101975221-101975243 TACATTTAACCCTATGGGGTTGG - Intronic
1124022746 15:25939076-25939098 TGTGTTCAATCGCCTGGGGTAGG - Intergenic
1124389073 15:29237468-29237490 TATATTTAATCCCATTAGGTTGG + Intronic
1124809222 15:32917555-32917577 TGTATTTAATCATATGAGGCGGG + Intronic
1127067095 15:55251995-55252017 TGTACTTAATCCCTGTGGGTTGG - Intronic
1128629974 15:69254842-69254864 TGTATTTAAAGGCATGAGGTTGG + Intronic
1128719616 15:69938704-69938726 TCTATTTATTCCAATGGGGCGGG - Intergenic
1129683868 15:77673684-77673706 AGTATTTAAAGCCATGAGGTTGG - Intronic
1131594247 15:93780943-93780965 TGCATTAAATCCTATGTGGTGGG + Intergenic
1132110251 15:99097538-99097560 TGTATTTAAAGCCATGAGATTGG + Intergenic
1135219390 16:20600548-20600570 GGTATTTAATACCATGAGATGGG - Intergenic
1136641096 16:31565900-31565922 TTTATTTAAGCCCATGGGTTTGG - Intergenic
1136663877 16:31791420-31791442 TTTATTTAAGCCCATGGGTTTGG + Intronic
1139405154 16:66712172-66712194 TGTATTGAAGACCATGGGCTAGG + Intergenic
1141209776 16:81966904-81966926 TGAAATTGATGCCATGGGGTGGG - Intergenic
1147517825 17:41138828-41138850 TGTATTTAATAGCATGGTCTTGG - Intergenic
1149297653 17:55275049-55275071 TTTATTTAATCCCATGAGCCAGG - Intronic
1149454473 17:56776835-56776857 GGTATTTAATGCCATGGAGTGGG - Intergenic
1150354591 17:64472218-64472240 CGTCTGTAATCCCATGGGGCAGG + Intergenic
1152046183 17:77937326-77937348 TGTGCTTAATCCCATTGGGTTGG - Intergenic
1153268394 18:3294963-3294985 TGTGTTTAGTTCCATGAGGTTGG + Intergenic
1155074023 18:22339595-22339617 TCTATTTAATCCCATAGGTTTGG - Intergenic
1156325879 18:36074809-36074831 TGTATCAAAGCCCATGGGCTGGG - Intergenic
1158387260 18:57008903-57008925 ACTATTTAATCCCATGAGGTAGG + Intronic
1162424591 19:10586940-10586962 TGTATTAATTCTCATTGGGTGGG + Intronic
926329415 2:11812429-11812451 TGTGTTTCATCGCATGGGGGAGG + Intronic
926765189 2:16317986-16318008 TGTATTAAATCCCCTCTGGTTGG + Intergenic
927495342 2:23548136-23548158 TCTCTTTAACCCCATGAGGTTGG - Intronic
928782490 2:34841141-34841163 TTAGTTTAATTCCATGGGGTTGG + Intergenic
932557741 2:72840453-72840475 TCAATTTAATCCTATGAGGTAGG - Intergenic
935744087 2:106175834-106175856 TGTATTTATACCCATGGGCTTGG - Intronic
937056498 2:118941732-118941754 TGGATTTGATCTGATGGGGTGGG + Intergenic
943799618 2:192041947-192041969 TGCCTGTAATCCCATGGGCTGGG + Intronic
947623115 2:231603648-231603670 TATATTTGAATCCATGGGGTTGG - Intergenic
1169447927 20:5688018-5688040 TGTAATTCATCACATGGAGTGGG - Intergenic
1170060628 20:12255029-12255051 TCTTTTTAACCCAATGGGGTAGG + Intergenic
1170493468 20:16901439-16901461 TGTAATTAATCCCATTTGGAGGG + Intergenic
1171785262 20:29458198-29458220 TTTATTTAATTCAATGGGGAGGG + Intergenic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1177755342 21:25340582-25340604 TGTATTTCATTCCATAGTGTTGG + Intergenic
1178539011 21:33433795-33433817 TTTTTTTAATGGCATGGGGTTGG + Intronic
1178677055 21:34639943-34639965 TGTATTTAATGCCACCGGATTGG - Intergenic
1179588471 21:42389206-42389228 TGTTTTGAATTCCAAGGGGTGGG + Intronic
950119826 3:10474419-10474441 GGTATTTAAAGCCATGGGATGGG + Intronic
950140619 3:10612601-10612623 CGTATTTAAAGCCATGGGGCTGG - Intronic
951108418 3:18772313-18772335 TGAATTTCATCTGATGGGGTTGG + Intergenic
951935480 3:28018104-28018126 GGTATTTGCTGCCATGGGGTGGG - Intergenic
961908628 3:130290005-130290027 TGTATTTAATAGTATGAGGTAGG + Intergenic
961926927 3:130491136-130491158 ATTATTTAATCCGATGAGGTTGG - Intergenic
962322656 3:134404656-134404678 GGTATTTAAAGCCATGGGGATGG + Intergenic
964840727 3:160990761-160990783 TGTTTATAATCACATGGGCTTGG - Intronic
965732386 3:171785905-171785927 TGCATTTAATCCCATTGAATGGG - Intronic
965748224 3:171947784-171947806 TGTTTTTATTTCTATGGGGTTGG + Intergenic
972031159 4:34459953-34459975 AGTATTTTATCCCAGTGGGTGGG + Intergenic
972903298 4:43712177-43712199 TGTACTCAATCCCTTGGGCTTGG + Intergenic
973848135 4:54934015-54934037 GGTATTTAAAACCATGGGATTGG - Intergenic
974001139 4:56511837-56511859 GGTATTTAATGCCATGAGGATGG - Intronic
978337302 4:107683447-107683469 TGAAATCAATCTCATGGGGTGGG - Intronic
983034927 4:162852028-162852050 TGAATTTATTTCCATGGGGGCGG + Intergenic
984147063 4:176074713-176074735 TGTATTTAATCCCAGTGCTTGGG - Intronic
985983338 5:3489963-3489985 GGGATTAAATCCCATGGGGAGGG + Intergenic
986470512 5:8069172-8069194 TGTATTTAATCCCATTGTTTAGG + Intergenic
987587965 5:19881846-19881868 TGTAATTAAGCCCATCAGGTAGG - Intronic
987861067 5:23488870-23488892 TGTTTTTATTTCTATGGGGTTGG + Intergenic
988443744 5:31261427-31261449 TGTAGATCATCCAATGGGGTAGG + Intronic
989317777 5:40102675-40102697 CGTAGTTACTGCCATGGGGTTGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
992674293 5:79090309-79090331 TGGATTTGAACCCATGGGGCTGG + Intronic
995841387 5:116446599-116446621 TGTACATAATCCCAGGGGGAGGG - Exonic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
997221612 5:132171267-132171289 TATGTTTAATTCCATGTGGTTGG - Intergenic
997686003 5:135788480-135788502 GATATTTCTTCCCATGGGGTGGG + Intergenic
1000409604 5:160924260-160924282 TGTGTTTAATCACACAGGGTTGG + Intergenic
1000493640 5:161949190-161949212 TTTACTTACTCCCATGGGTTTGG + Intergenic
1002912845 6:1504270-1504292 TGTATTGAAGCCTATGGGCTGGG + Intergenic
1004398901 6:15270457-15270479 TGTATTTGATCCTATTGGTTAGG + Intronic
1011450620 6:87488228-87488250 AGTATTTAATCTCATGGAATTGG + Intronic
1014053416 6:116984243-116984265 TCAATTAAATCCCATGGGGTTGG - Intergenic
1014620888 6:123665953-123665975 TTTATTTTATCATATGGGGTTGG + Intergenic
1025269806 7:57499467-57499489 AGTATTTTATCCCAGTGGGTGGG - Intergenic
1026210635 7:68300858-68300880 TGTATGTAATCCCAGGGCTTTGG - Intergenic
1026279685 7:68911130-68911152 TGTGTATAAACCCATGGGATTGG + Intergenic
1033790869 7:144791043-144791065 AGTATGTAAACCCATGGGGTAGG + Intronic
1036508021 8:9373694-9373716 TGTATATCCTCCCAGGGGGTAGG - Intergenic
1037009641 8:13824544-13824566 TCTATTTAAGCCCAGGGGGGTGG - Intergenic
1044913018 8:97081917-97081939 TTTATATAATCTCATGAGGTAGG - Intronic
1045757582 8:105562906-105562928 TTTCTTTTATCCCATGTGGTAGG - Intronic
1049045091 8:140143615-140143637 TGTCTTAAAGACCATGGGGTAGG - Intronic
1050096230 9:2069717-2069739 TGTTTTTATGCCCATGGAGTGGG + Intronic
1054979614 9:71189816-71189838 AGTATATAATCCCATTGGATGGG - Intronic
1054981752 9:71214729-71214751 TGTTGTTAGTCCCATGTGGTTGG - Intronic
1059499618 9:114739886-114739908 CTTATTTAATCCTATGGGATGGG + Intergenic
1059551918 9:115237584-115237606 TGTATTTCATCACATGGCCTTGG - Intronic
1059816144 9:117917978-117918000 TGTCTCTAATGCCCTGGGGTAGG + Intergenic
1202801498 9_KI270720v1_random:3655-3677 TGTCTTTAATTCAATGGGGAGGG + Intergenic
1203446050 Un_GL000219v1:57429-57451 TGTATTTAATTCAATGGGGAGGG + Intergenic
1189110343 X:38283202-38283224 TTTATTTAATCACATGTGGCAGG - Intronic
1190503200 X:51099394-51099416 GTTATTTAATTCTATGGGGTAGG - Intergenic
1193878048 X:86886333-86886355 TTTGTTTAAACCCATGGAGTGGG + Intergenic
1194567339 X:95507305-95507327 GGTTTTTAATCCTATTGGGTTGG - Intergenic
1194911691 X:99653030-99653052 TGTATTTAATGCCATTGTATTGG - Intergenic
1195967517 X:110442042-110442064 TCAATTTAACCCCATGGGTTAGG - Intronic
1197270267 X:124417605-124417627 TGTATTTAAAACCATGAGATGGG - Intronic
1197631958 X:128871406-128871428 TGTATTTTGTCTCATTGGGTGGG + Intergenic
1199068862 X:143452602-143452624 TTTCTTTAATCCTGTGGGGTAGG - Intergenic
1200037368 X:153340675-153340697 TGTATGTGACCACATGGGGTTGG - Intronic