ID: 1069025111

View in Genome Browser
Species Human (GRCh38)
Location 10:63531399-63531421
Sequence GCCAAAAATGGCTCCAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069025108_1069025111 -8 Left 1069025108 10:63531384-63531406 CCACCAGTTGTGACAGCCAAAAA 0: 8
1: 52
2: 243
3: 555
4: 952
Right 1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG No data
1069025107_1069025111 21 Left 1069025107 10:63531355-63531377 CCTGTGCATTGTGGGATGTTTAG 0: 13
1: 167
2: 660
3: 1144
4: 1515
Right 1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069025111 Original CRISPR GCCAAAAATGGCTCCAGATA TGG Intronic
No off target data available for this crispr