ID: 1069027588

View in Genome Browser
Species Human (GRCh38)
Location 10:63560495-63560517
Sequence ATGAAAAATAAAACCACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 0, 2: 10, 3: 75, 4: 760}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069027588 Original CRISPR ATGAAAAATAAAACCACTTA TGG (reversed) Intronic
900661681 1:3787732-3787754 AAAAAAAATAACACCACTTTGGG - Intronic
900726586 1:4220300-4220322 ATGAAGAATAAAATCATTTCAGG - Intergenic
901308150 1:8248517-8248539 AAAAAAAAAAAAACCACTAATGG - Intergenic
903802969 1:25983561-25983583 ACAAAAAAAAAAACAACTTATGG + Intronic
904024687 1:27495052-27495074 CTGGAAAATAAAAACAATTATGG - Intergenic
904205885 1:28855108-28855130 ATGAAAAATGAAGCCGCTGAAGG + Intronic
904992813 1:34607433-34607455 TTGAAAAATATTACCACTTGGGG - Intergenic
905520212 1:38593068-38593090 ATGAAAAACAATAAAACTTATGG - Intergenic
906994225 1:50772916-50772938 ATAAAAAACAAAAGCACTTTGGG + Intronic
907790034 1:57654136-57654158 ATGAAAAAGCAAATCACTGAAGG - Intronic
908015775 1:59833871-59833893 ATGAAAACTGAATCCACATAAGG - Intronic
908139349 1:61167720-61167742 ATGAGAAATAACACCATTTTTGG - Intronic
908307812 1:62841685-62841707 TTGAAAAATAAAGCCATTTGAGG + Intronic
909152865 1:72030884-72030906 ATGGAAAAAAAAACAACTGAAGG + Intronic
909389181 1:75098768-75098790 AATAAAAACAAAACTACTTATGG + Intergenic
910131928 1:83917708-83917730 ATTAAAATTACAACCACTAATGG + Intronic
910335476 1:86124824-86124846 ATTAAAAAAAAAAAAACTTACGG + Exonic
910457043 1:87408907-87408929 ATTCAAAATAAAACAACTCAAGG + Intergenic
910543361 1:88386519-88386541 AAGAAAAATAAAACCAAGTTCGG - Intergenic
910575805 1:88762427-88762449 ATGAAAAATAAAAACAGTTAAGG - Intronic
910731112 1:90398344-90398366 ATTAAAAATGATACCACTTAGGG - Intergenic
911205790 1:95090450-95090472 ATGAAAAATGAAACCATGTGGGG - Intergenic
911393540 1:97276585-97276607 ATGAAAATCAAAACCACAAAGGG + Intronic
911399316 1:97354911-97354933 ATGAAAAATAAAGAAACTGATGG - Intronic
911508284 1:98781584-98781606 AAGAAAAATGAATGCACTTAGGG + Intergenic
911627685 1:100144413-100144435 AAGGAAAATAAGACCATTTATGG + Intronic
911768899 1:101714125-101714147 AGGAAAAAGAAAACAACTTGTGG - Intergenic
911810385 1:102269537-102269559 ATCAAAAATAAAGCAACATAAGG - Intergenic
912765928 1:112410421-112410443 TGGAAAAATAAACCCATTTAAGG - Intronic
913434069 1:118828807-118828829 AAGAAAAATAAAGCAAGTTAAGG + Intergenic
914350816 1:146838501-146838523 CTGAAAAATATAATAACTTAAGG - Intergenic
914449090 1:147774773-147774795 ATGAAAAATATAGCCCATTAAGG - Intergenic
916051734 1:161041273-161041295 AAAAAAAAAAAAACCACTTACGG + Intronic
916298261 1:163244583-163244605 ATGAAAAATAAAGTAAATTAAGG + Intronic
916600896 1:166292613-166292635 AAAAAACATAAAAACACTTAGGG + Intergenic
916960057 1:169880572-169880594 AGGCAAAATAAAAGCACTTTTGG + Intronic
916965527 1:169938279-169938301 ATGTAAAATATAGCTACTTAAGG + Intronic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
918866801 1:189910895-189910917 ATGAAAAATAAAAGCTATAATGG - Intergenic
918867624 1:189923394-189923416 TTAAAAAAGAAAACCACATAAGG + Intergenic
918910410 1:190560591-190560613 ATGTAAATAAAAAACACTTATGG + Intergenic
919166474 1:193901252-193901274 CTTAAAAATAAAATTACTTATGG + Intergenic
919263780 1:195235913-195235935 AAAAAAAATAAAATCAATTAAGG - Intergenic
919531802 1:198730303-198730325 AAGAAAAATAAAGCCTTTTAAGG - Intronic
919948047 1:202336513-202336535 ACAAAAAATAAAAACACTAAAGG + Intronic
920233829 1:204489326-204489348 AATAAAAATAAAAACAATTAGGG - Intronic
920713417 1:208316940-208316962 ATCAAAAATAAAACCAAGAATGG - Intergenic
921079671 1:211728678-211728700 ATGAAAATTAAAACCACCAAGGG - Intergenic
921166187 1:212508931-212508953 AGGGAAAATAAAACCATTTCTGG - Intergenic
922075114 1:222235918-222235940 AAGAAAAATAAAGCAACATAAGG - Intergenic
922147743 1:222964999-222965021 TTGAAAAAAAAAACTACTGAAGG - Intronic
922943585 1:229490960-229490982 AAGAAAAAAAAAACAACTTGTGG + Intronic
924257337 1:242195537-242195559 CTTGAAAATAAAAACACTTAAGG + Intronic
1063014550 10:2063268-2063290 ATAAAAAATAAAACAACTTTAGG + Intergenic
1063768699 10:9172833-9172855 CTGAAAACTAAAACCAAGTAAGG - Intergenic
1064318909 10:14283530-14283552 ATGAAAAATAAATCCAAGAAGGG + Intronic
1064333029 10:14411589-14411611 ATGAAAAAAAAATCCACAGAGGG - Intronic
1064728363 10:18303937-18303959 ATAAAAAATAAAAACACTGGCGG - Intronic
1064803084 10:19098646-19098668 ATAAACATTAAAAACACTTACGG - Intronic
1064915131 10:20448279-20448301 ATGAAAAATAATACCACTTTTGG + Intergenic
1066050450 10:31630534-31630556 ATCAAAATTAAAAACTCTTATGG - Intergenic
1066408144 10:35139542-35139564 ATTAAAAATAAAAACATGTAAGG - Intronic
1066498373 10:35964873-35964895 AGAAAAAAAAAAACCACATAGGG + Intergenic
1066629247 10:37442391-37442413 ATGAAAAATAACTCCATTTTTGG + Intergenic
1066807614 10:39276871-39276893 ATGAAAAAGGAAACCACTTCAGG - Intergenic
1067255101 10:44630127-44630149 AAGAAACATAAATCTACTTAGGG + Intergenic
1067345577 10:45435984-45436006 ATGCAAATTAAAACCACAAAGGG - Intronic
1067715594 10:48688529-48688551 ATAAAAATATAAACCACTTAGGG - Intronic
1067915801 10:50396770-50396792 GTGAAAAATAATGCCACTTGTGG - Intronic
1068156691 10:53207779-53207801 ATGAGAAAAGAAACCACTCACGG - Intergenic
1068391236 10:56399794-56399816 ATGTAAAATAAATCCAGTGAAGG + Intergenic
1068394245 10:56441267-56441289 ATGAAAAATAAAGTAAATTAAGG + Intergenic
1068464656 10:57374146-57374168 ACAAAAAATAAAAACACTTGAGG + Intergenic
1068802190 10:61154024-61154046 ATGAAAACTAAATCCACTGTTGG + Intergenic
1068916196 10:62434319-62434341 ATGAAAAACAAATCAACTGATGG + Intronic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1069253112 10:66296849-66296871 AAGAAAAGTAGAACTACTTAGGG + Intronic
1069347262 10:67484729-67484751 ATGCAAAATAAAACCACAATGGG + Intronic
1071114194 10:82198070-82198092 ATGAAAAATAAAACCTTACATGG + Intronic
1071824869 10:89315585-89315607 AAGAAAAAAAAAACCTCTCAGGG + Intronic
1071895191 10:90058833-90058855 ATGAAAAAGAAAACAAATTTTGG - Intergenic
1072395096 10:95031232-95031254 ATTAAAAAAAAAATCACTGAAGG - Intergenic
1072744781 10:97932500-97932522 AAGGAAAATAAAGCCAGTTAAGG + Intronic
1073772118 10:106746102-106746124 ATGAAAAATAAATGCAATTTGGG + Intronic
1074131297 10:110579559-110579581 AAGAAAAATAAAACAGATTAAGG - Intronic
1075227598 10:120643765-120643787 CTGGAAAATAAAATCACTGAAGG + Intergenic
1075421831 10:122307389-122307411 ATGAAAAATTATATCACTGATGG - Intronic
1075808876 10:125210008-125210030 AGGGAAAAAAAACCCACTTATGG + Intergenic
1075878879 10:125832529-125832551 AAAAAAACAAAAACCACTTAAGG - Intronic
1076930913 10:133531243-133531265 ATGCTACATAAAACCACATATGG - Intronic
1077179586 11:1206353-1206375 ATAAAAAATAAAACCCCAGAGGG + Intergenic
1077389775 11:2294950-2294972 AGGAAAAATGAAAACACCTAGGG + Intergenic
1077423805 11:2465147-2465169 ATAAAAAATAAAAAAACTTCTGG - Intronic
1078300869 11:10130976-10130998 ATTGAAAATAAAACCATGTATGG + Intronic
1078325835 11:10380174-10380196 ATGAGAAGCAAAACCACTTGGGG + Intronic
1078605709 11:12773479-12773501 ATGCAAATTAAAACCACATGAGG - Intronic
1078744587 11:14099453-14099475 ATTAATAATAAATGCACTTAAGG + Intronic
1079218758 11:18539412-18539434 ATGAAAAATATAAATACATATGG + Intronic
1079432514 11:20406955-20406977 ATAAAAACTGAAACAACTTATGG - Intronic
1080469749 11:32533737-32533759 ATTAAAAACAAATCCACTCAAGG - Intergenic
1080634855 11:34114770-34114792 AAGAAAAATAAAGCCGGTTAAGG - Intronic
1080876272 11:36277317-36277339 ATGAAAACTGACAACACTTAGGG - Intronic
1080955334 11:37087182-37087204 AAGAGAAATTAAAACACTTAGGG - Intergenic
1081643718 11:44775779-44775801 ATGAAAAATAAATTCATTGATGG - Intronic
1081922355 11:46790601-46790623 AATAAAAATTAAACCACCTAAGG + Intronic
1082919029 11:58471645-58471667 ATGAAAAAAAAAAACCCATAAGG + Intergenic
1083100016 11:60293313-60293335 TTAAAAAATAAACCCACTTTGGG - Intronic
1084023052 11:66429690-66429712 ATAAAAAATAAAAAAAGTTATGG - Intergenic
1084139854 11:67219098-67219120 AGGATAAATAATACCTCTTATGG - Intronic
1085379723 11:76103955-76103977 ATTAAAAAAAAAAACACTTGAGG + Intronic
1085612083 11:77959734-77959756 ATGAGAGATAAAACCACTCTTGG + Intronic
1085767503 11:79295850-79295872 TTAAAAAAAAAAAACACTTACGG - Intronic
1085814154 11:79718148-79718170 ATGTAAAATTTAACCACATATGG - Intergenic
1086000722 11:81982384-81982406 AAGAAAAATAATACAATTTATGG - Intergenic
1086021298 11:82233001-82233023 ATGAAGGATAAAACTACATAAGG - Intergenic
1086099146 11:83080842-83080864 ATGATTAATAAAGCCACCTAAGG + Intergenic
1086449589 11:86902968-86902990 ATGAAAAATAACAGCACAGAGGG + Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1087691619 11:101326903-101326925 ATGAATAAAAACACCAATTATGG - Intergenic
1087727554 11:101739712-101739734 AAGAAAAATAAAGCCAAGTAAGG + Intronic
1088518864 11:110672423-110672445 ATGCAAATTAAAACCACAAAGGG + Intronic
1089811368 11:121134566-121134588 ATGAAAAAAAAAAAGACTTTGGG - Intronic
1089919306 11:122193369-122193391 AAGTAACATAAAACCAATTAAGG + Intergenic
1090442421 11:126735503-126735525 CTGAAGAATAAAACCTCTCATGG + Intronic
1090475723 11:127018406-127018428 AAGAAAAAAAAAACCACTGCAGG - Intergenic
1090545565 11:127763108-127763130 ATTTTAAATAAAACCACTTCTGG - Intergenic
1091080635 11:132664089-132664111 ATTAAAATTAAATCCACTTTGGG - Intronic
1091192133 11:133704927-133704949 ATGGAAGAGAAAACCACTTCTGG - Intergenic
1091432196 12:445880-445902 AAAAAAAAAAAAAGCACTTAAGG - Intergenic
1092887318 12:12936379-12936401 ATAAAACATAAAACTATTTATGG - Intergenic
1092952307 12:13517847-13517869 ATGAAAAACAAAACCTCTTCAGG - Intergenic
1093424043 12:19008155-19008177 ATGAAAAATAAAACCATAGTGGG + Intergenic
1093474290 12:19537616-19537638 ATGAATAATAAAACCAGGCACGG + Intronic
1094671489 12:32574323-32574345 AAAAAAAAAAAAAACACTTAAGG - Intronic
1095557855 12:43529078-43529100 ATGCAAATTAAAACCACATTGGG + Intronic
1095573385 12:43707642-43707664 AAGAAAAAGAAAACTACTAAAGG + Intergenic
1096305921 12:50475493-50475515 ATGATAAAAAAAAACATTTATGG - Intronic
1096360289 12:50979475-50979497 CTGAGAAATAAAACCACCCAGGG + Intronic
1096449489 12:51725818-51725840 ATGAAAATTAATACCTCTTGGGG + Intronic
1097432808 12:59529915-59529937 ATTAAAAATAATATCACATAGGG - Intergenic
1097473977 12:60031316-60031338 ATGAAACTTGAAACCACTCAAGG - Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098203421 12:68081408-68081430 ATGTAAAAAAAAAACCCTTAAGG + Intergenic
1098232000 12:68380933-68380955 ATGAAAAATAAATCCCTTTGTGG - Intergenic
1098257407 12:68630923-68630945 ATGAAAAAAAAAACAAATTCAGG - Intronic
1098315598 12:69189563-69189585 AAAAAAAATAAATCCTCTTATGG - Intergenic
1098334952 12:69394097-69394119 AGGAGAAAGAAAACCCCTTAGGG + Intergenic
1098585509 12:72149907-72149929 ATGAAGAATCAAAGTACTTATGG - Intronic
1098948513 12:76614865-76614887 ATTAAAAATAAAAGCACTGTTGG - Intergenic
1099091289 12:78312778-78312800 GTGAAAAAGAAAAACACCTACGG - Intergenic
1099249886 12:80241408-80241430 ATTAAAAATGAAACCAAATAGGG - Intronic
1099301058 12:80894876-80894898 AAGAAAAATAAAAACAACTAAGG + Intronic
1100107159 12:91189788-91189810 CTGGAAAGTAAAACCACATAGGG + Intergenic
1100585686 12:95977383-95977405 ATTAAAAAAAAAACCACTTTGGG + Intronic
1100682766 12:96947171-96947193 ATTAAAAATAACAGAACTTAGGG - Intronic
1100744227 12:97627890-97627912 ATCAAAGAAAAAACCACCTAAGG + Intergenic
1100794821 12:98170659-98170681 ATGAAATTTAAAGACACTTATGG - Intergenic
1102151680 12:110692742-110692764 AACAAAAACAAAACAACTTAGGG + Intronic
1102702009 12:114847636-114847658 CGGAAAAATAAAACCGCTGAAGG + Intergenic
1102775145 12:115512143-115512165 ATGAAAAACAAAATCACTGAAGG - Intergenic
1103145370 12:118590714-118590736 ATGATAAATAAACCCGATTAAGG + Intergenic
1103673453 12:122637174-122637196 ATGGAAAACACAAACACTTAGGG + Intergenic
1104264335 12:127217126-127217148 AGGAAAAAAAAAAAGACTTATGG - Intergenic
1104317396 12:127716495-127716517 ACTAAAAATAAAATCACTTTGGG + Intergenic
1104367707 12:128192882-128192904 ATGAAAAGTAAATGTACTTATGG - Intergenic
1104407456 12:128530037-128530059 TCTAAAAATAAAACCACTCAGGG - Intronic
1105349883 13:19605554-19605576 ATGAAAAATAAATGCACTGAAGG + Intergenic
1106368790 13:29111090-29111112 ATAAAAAATGGAACCACTTATGG + Intronic
1106557334 13:30821452-30821474 ATGATTAATAAAATCACTTGGGG + Intergenic
1106676099 13:31959988-31960010 CTGCAAAATAAAACCAGTTGAGG - Intergenic
1107143244 13:37027933-37027955 ATTAAAAATAAAAAAACCTATGG - Intronic
1107218725 13:37954015-37954037 ATTAGAAATAAAATCACTTATGG - Intergenic
1107727315 13:43311984-43312006 AAGAAAAATAAAATCTCTCATGG + Intronic
1108067503 13:46593254-46593276 AAGAAAGAAAAAACCTCTTAAGG - Intronic
1108146257 13:47480516-47480538 ATGCAAAATAACACAAATTATGG - Intergenic
1108173406 13:47767512-47767534 AGGAAAAAAAAAATCATTTATGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108837238 13:54566627-54566649 ATGATCCATAAAACCACCTAAGG - Intergenic
1108839066 13:54589874-54589896 ATGAAAAATAAAATGACATTAGG + Intergenic
1109093854 13:58085743-58085765 ATGAAAAAGAAGACCAGTTTGGG + Intergenic
1109238616 13:59854904-59854926 ATGAAGAAGAAAACCACATCAGG - Intronic
1109397067 13:61773774-61773796 ATGAAATATAAAATCACACAGGG + Intergenic
1109400985 13:61828527-61828549 AAGGAAAAAAAAATCACTTATGG + Intergenic
1109467627 13:62758320-62758342 AAGAAAAGTAAAAAAACTTATGG + Intergenic
1109511792 13:63386375-63386397 AGGAAAAATAAAACCTCTTCTGG - Intergenic
1109615612 13:64829934-64829956 AAGAGAAATAAAACCCTTTACGG + Intergenic
1109821423 13:67661104-67661126 ATGAAACAGAAATTCACTTAAGG - Intergenic
1110145502 13:72185663-72185685 ATGAAAAACTAAATCATTTACGG + Intergenic
1110146376 13:72195978-72196000 AGGGAAAATAAAAGCACTTTTGG - Intergenic
1110806083 13:79756234-79756256 ATGAAAGATAAAGTCAATTAGGG + Intergenic
1110920273 13:81075601-81075623 TTAAAAAATAAAACCAATGATGG + Intergenic
1111275488 13:85940023-85940045 ATTTAAAATAAATCCACTTAAGG + Intergenic
1111972588 13:94932417-94932439 TTTAAAAATAAAACCATTTTTGG + Intergenic
1112389047 13:98966043-98966065 AGGAATAATAATACCAATTAAGG + Intronic
1112422279 13:99263432-99263454 ATGAAAATTAAAACCACAGCAGG + Intronic
1112575846 13:100636016-100636038 ATGAAAAAGAAAACTGTTTAAGG - Intronic
1112711386 13:102132820-102132842 GTCAAAAGTAAACCCACTTAAGG - Intronic
1114252903 14:20976648-20976670 ATGCAAAATAAAAGGAGTTAGGG + Intergenic
1114887085 14:26866324-26866346 ATGTAAAATAAAAACACATGAGG - Intergenic
1115023569 14:28713192-28713214 AAAAAAAAAAAAACCACTAAGGG + Intergenic
1115056382 14:29132786-29132808 ATGAGAAATAATACCACACAAGG - Intergenic
1115173062 14:30530032-30530054 AAAAAAAAAAAAACCACCTATGG - Intergenic
1115173901 14:30540091-30540113 ATTAAAAAAAAAATCACTCAAGG - Intergenic
1115441114 14:33437027-33437049 ATGAGAAGTAAAAACACATATGG + Intronic
1116013326 14:39376807-39376829 TTGCAAGATAAAACCACATAGGG + Intronic
1116014451 14:39389506-39389528 ATGAACAATAATGCCATTTATGG + Intergenic
1116766401 14:49075837-49075859 ATGCAAAAGAAAACCACTTGAGG + Intergenic
1117428157 14:55622640-55622662 AGAAAAAATTAAACCACTGAAGG - Intronic
1118097847 14:62559305-62559327 ACAAAAAATAAAAGCACTTCTGG + Intergenic
1118107703 14:62678923-62678945 ATAAAATGTAAAACCACTTTTGG - Intergenic
1118814916 14:69304423-69304445 ATAAAAGAAAAAACCACATATGG - Intronic
1118963642 14:70559303-70559325 ATGAAAAAAAAAAGGAATTAAGG - Intergenic
1119081204 14:71695890-71695912 ATGAAAATGAAAACCAAGTAAGG - Intronic
1119501650 14:75133414-75133436 ATGCAAATTAAAACCACATGTGG + Exonic
1119570511 14:75667059-75667081 CTAAAAAAAAAAAGCACTTAAGG - Intronic
1119960140 14:78846708-78846730 AATAAAAATGAAACCACTTATGG + Intronic
1120120732 14:80677626-80677648 GTTAAAAAAAAAATCACTTAAGG + Intronic
1120165688 14:81196439-81196461 ATGAAAAATAAAACATTTTAAGG - Intronic
1120244555 14:81991703-81991725 ATGAAAAACAAAGCCTCTGAAGG + Intergenic
1120724663 14:87924462-87924484 AAGAAAAAAAAAACCTCTTCTGG + Intronic
1121202570 14:92131535-92131557 ATCAAAAAAAAAATCAATTATGG + Intronic
1121260711 14:92564173-92564195 AGTAAAAACAAAACCCCTTATGG + Intronic
1121291717 14:92781177-92781199 ATGAAAAATAAAACCAGGTAAGG + Intergenic
1122398481 14:101451981-101452003 ATAAAAAATTCAACCACTTTGGG + Intergenic
1122431306 14:101648328-101648350 ATAAAAAATAAAAAAACTAATGG + Intergenic
1122547251 14:102530507-102530529 AAAAAAAATAAAACCAGGTACGG - Intergenic
1124390586 15:29252935-29252957 ATCAATAATTAATCCACTTACGG + Intronic
1125092956 15:35816143-35816165 AAGAAAAAGAAAACTACTTTAGG + Intergenic
1125250179 15:37692540-37692562 ATGAAAAATAAGAACATTAAAGG + Intergenic
1125313592 15:38407480-38407502 ATGAAAAAAAGAACCACCTTTGG + Intergenic
1126112197 15:45181860-45181882 ATAAAAAATAAAACCACGGCTGG + Intronic
1126194148 15:45912903-45912925 CTGAAAAAAAAAATCTCTTATGG + Intergenic
1126247240 15:46522878-46522900 ATAAAAGATAAAACAACTAAAGG + Intergenic
1126310364 15:47309157-47309179 GTGAAAAGCAAAACCACTGATGG - Intronic
1126432724 15:48603520-48603542 ATCCAAAATAAAACCAATTTCGG - Intronic
1126961222 15:53996997-53997019 ATGTAAAATAAAATCACCTTAGG - Intergenic
1127524443 15:59778425-59778447 AGGAAAAACAAAACCACCTATGG - Intergenic
1128581294 15:68812027-68812049 AAAAAAAAAAAAACAACTTAGGG - Intronic
1128910990 15:71514682-71514704 AGAAAAAATAAAACCTCCTATGG + Intronic
1129017945 15:72485598-72485620 ATAAAAAACAAAACCATTCAGGG - Intronic
1130119596 15:81036199-81036221 ATGAAAAAAAAAAGAAATTATGG - Intronic
1130405000 15:83591465-83591487 ATGAAAAAAAAAAACCTTTAAGG - Intronic
1131039033 15:89244979-89245001 ATGATAAACAAAACCAGCTACGG + Intronic
1131588427 15:93721226-93721248 GTGAATAATAAAACCACTTTTGG + Intergenic
1131654451 15:94441139-94441161 AGGAAAAATAAAAACAGTCAGGG - Intronic
1131860667 15:96650057-96650079 ATGAAAAATAAATCCAGTATTGG - Intergenic
1131892973 15:96993902-96993924 ATGAAAAATTAAGCCACTATTGG - Intergenic
1132217372 15:100075249-100075271 ATGAAAACTAAAACAACTATAGG - Intronic
1133023539 16:2977454-2977476 ATGAAAAAGAAAGACACTTGAGG - Intronic
1134147413 16:11777418-11777440 GTGAAAATTAAAAGCACTTCAGG + Intronic
1134158180 16:11861397-11861419 ATGTAAAAGAAAACCAATTTAGG + Intergenic
1134219189 16:12340127-12340149 ATGAAAAAGAAAACAATTTTTGG - Intronic
1134259083 16:12636391-12636413 AAAAAAAAAAAAACCACTTATGG + Intergenic
1134449127 16:14353174-14353196 ATGAAAAATAAAAACCCAGAAGG - Intergenic
1134588417 16:15432626-15432648 ATGAAAAAATAGACCAATTATGG + Intronic
1135697348 16:24601495-24601517 CTTAAAAAAAAAACCATTTAGGG - Intergenic
1135885384 16:26301423-26301445 ATGCAAAATAGAAGCATTTATGG + Intergenic
1135910738 16:26558463-26558485 ATGAAGAATGTAAACACTTAGGG + Intergenic
1135995318 16:27243642-27243664 ATATAAAATAAAATCAATTAGGG - Intronic
1136864464 16:33733860-33733882 ATTAAAAAAAAATCCACTCAGGG - Intergenic
1137958569 16:52857919-52857941 ATTACAAATAAGACCACTTCTGG + Intergenic
1138225676 16:55292386-55292408 CTGAAAAATAAAGCAAATTAAGG + Intergenic
1139983219 16:70877043-70877065 CTGAAAAATATAATAACTTAAGG + Intronic
1140461137 16:75140653-75140675 ATAGAAAATAAAAACACTTGGGG + Intergenic
1140894785 16:79315278-79315300 AAGAAAAATGAAGCCAGTTAGGG + Intergenic
1141598017 16:85109085-85109107 AGGAAAAATAAAACTTCTCACGG - Intronic
1141870332 16:86781014-86781036 GTGTATAACAAAACCACTTAAGG + Intergenic
1143346212 17:6251062-6251084 AGGGAGAATAAAACCACTTTGGG + Intergenic
1143410902 17:6707944-6707966 ATGAAACATAAAACAACCTAGGG - Intronic
1143429275 17:6867867-6867889 ATGAGAAACAAAACCACTAAGGG - Intergenic
1143504178 17:7354913-7354935 AAGAAAAATAAAACTGCTTTTGG + Exonic
1143998052 17:11025522-11025544 ATGAAAAATAAAACCCCTATAGG + Intergenic
1144135129 17:12288061-12288083 CTGAAAAATAAAACCATCAAAGG - Intergenic
1146796754 17:35786992-35787014 ATGTAAAATAAAACATCCTAGGG - Intronic
1146898136 17:36560747-36560769 ATTAAAAATAAAACATATTAAGG - Intronic
1147863407 17:43537385-43537407 ATAATAAATAAAATCACATAGGG + Intronic
1148530023 17:48381025-48381047 CTGAAAAATAAAATCAAGTATGG + Intronic
1150168895 17:62971168-62971190 ATGAAAAAAAAAATGAGTTAAGG + Intergenic
1151055543 17:71027052-71027074 ATAAAAAATAAAAAAAATTAGGG - Intergenic
1151094121 17:71476728-71476750 ATGAAAAATGTAACGACTTTGGG - Intergenic
1152871608 17:82756779-82756801 ATGTAAACTAAAAACACTTGAGG - Intronic
1153967245 18:10192964-10192986 GTGAAAAATAAAATGCCTTATGG - Intergenic
1154110383 18:11563417-11563439 ATCCAACATAAAACCACTCAAGG + Intergenic
1154139965 18:11814553-11814575 ATGAAAAACAAAACACCATATGG + Intronic
1154153633 18:11927058-11927080 AAGAAAAAAAAAACAACTGAGGG + Intergenic
1155030526 18:21979825-21979847 TTGAAAAATACAGTCACTTAAGG - Intergenic
1155610785 18:27665125-27665147 ATTAAAAATAAAACCACCTGCGG - Intergenic
1155641995 18:28029442-28029464 ATTAAAAAAAAAACCAATGATGG - Intronic
1155864506 18:30948475-30948497 ATGAAAATGATAACCAATTAAGG + Intergenic
1156093807 18:33504881-33504903 ATGAAAATTAAAACCACAGTGGG - Intergenic
1157115780 18:44861489-44861511 ATGAATAAGAAATCCACTTTGGG - Intronic
1157149258 18:45199201-45199223 AATAAAAATAAACCCACATATGG - Intergenic
1157637491 18:49173552-49173574 TTGAAAAATAATGCCATTTACGG - Intronic
1157650092 18:49319466-49319488 AAGAAAGATAAAAACATTTAAGG + Intronic
1157832305 18:50867682-50867704 ATAAAAAATAAAAACATTTCTGG - Intergenic
1158098493 18:53802981-53803003 ATGAATAATGAAACAACTCAGGG + Intergenic
1158481898 18:57829386-57829408 ACGAAAAAAAAATCCTCTTAAGG - Intergenic
1158740322 18:60134656-60134678 CTGAAAAAAACAACAACTTAGGG - Intergenic
1158793583 18:60813332-60813354 AAAAAAAATAAAACCGCATAAGG + Intergenic
1159087619 18:63811642-63811664 ATGAAAGACAAAACTTCTTAAGG + Intergenic
1159384343 18:67703961-67703983 ATAAAAATAAAAACCATTTAGGG + Intergenic
1159509599 18:69379076-69379098 AAGATAAATAATACCACTTTGGG - Intergenic
1159820331 18:73133131-73133153 ATGCAAATTAAAACCACATGAGG + Intergenic
1159926409 18:74273553-74273575 GTGAAAAATCAACACACTTAAGG + Intronic
1160262634 18:77309454-77309476 ATGAAAATTAAAACCACAGTGGG + Intergenic
1162482813 19:10938801-10938823 AAGAAAAAAAAAAGGACTTAAGG - Intergenic
1162834450 19:13307220-13307242 AAGAAAAAAAAAACCACTTTGGG - Intronic
1163063878 19:14778880-14778902 ACAAAAAAAAAAAACACTTAAGG - Intergenic
1163679896 19:18675203-18675225 ATAAAAAAAAAAAAGACTTACGG - Intergenic
1164170490 19:22720694-22720716 AAGAAAACTAAAATCACTCAGGG + Intergenic
1164431046 19:28189108-28189130 GTAAAAAATAAAACCTCTTTTGG + Intergenic
1164814726 19:31186778-31186800 ATGAAAATTAAAACCATATTTGG - Intergenic
1164833685 19:31342508-31342530 ATGCAAAATAAATTCACTCAAGG + Intronic
1165575528 19:36813426-36813448 ATAAAAATTAAAAACACTTCTGG - Intergenic
1165760354 19:38317553-38317575 AAGAAAAAAAAAAACATTTATGG - Intergenic
1165806995 19:38586463-38586485 ATGAAAAATAAAATAAGGTAAGG + Intronic
1166044091 19:40219314-40219336 ATTAAAAATAATACCACCTTTGG + Intergenic
1166926658 19:46273625-46273647 AAGAAAAATAAAACGAAATAGGG + Intergenic
925575075 2:5351762-5351784 AAAAAAAAAAAAACCACTAAAGG + Intergenic
925792177 2:7501611-7501633 ATGAAAATTAAAACCACAGTGGG + Intergenic
925946565 2:8869558-8869580 ATAAACAATAAAACAATTTAAGG - Intronic
926199834 2:10786708-10786730 ATGGGAAATAAAACCTCTTTAGG + Intronic
926644166 2:15270818-15270840 ATGGAAAATAATACCATATATGG + Intronic
927334119 2:21901369-21901391 ATGAATAATAAAAGCATTTAGGG - Intergenic
927339099 2:21961009-21961031 ATGGAAAATAAAAGCATGTAAGG - Intergenic
928793200 2:34984002-34984024 ATGAAAAACGAAAGCACTTTTGG - Intergenic
929257540 2:39829201-39829223 AGGAGAAATAAAATCTCTTATGG - Intergenic
929929763 2:46244219-46244241 AAGAAAAATAAAACCTCTACTGG - Intergenic
930142983 2:47972133-47972155 AAAAAAAAAAAAACAACTTAGGG + Intergenic
930249768 2:49022242-49022264 TTGAAAAACAAATCCAGTTAAGG - Intronic
930445134 2:51461213-51461235 AAGAAAAATAAAAAGCCTTATGG + Intergenic
930458132 2:51632700-51632722 ATGAAGAAAAAAACCACTTTTGG + Intergenic
930756685 2:54981558-54981580 ATGAAAAAGAAAAGCACTACAGG + Intronic
930781574 2:55229231-55229253 AAGAAAAATAAAACAAGGTATGG + Intronic
930845029 2:55894806-55894828 AGGAAAAATGAAAGAACTTAAGG + Intronic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931109510 2:59095553-59095575 ATAAAAAATAAAATAACTCAAGG - Intergenic
931174375 2:59838308-59838330 ATGAAAACTAACACAACATAAGG + Intergenic
931772298 2:65508375-65508397 ATCAAAATTAAGAACACTTATGG - Intergenic
931862011 2:66365045-66365067 ATGAAAAAAAAAAAAAGTTAGGG - Intergenic
932250868 2:70242592-70242614 ATAAAAATGAAAACCTCTTATGG - Intronic
932302816 2:70678970-70678992 GACAAAAATAGAACCACTTATGG + Intronic
932759836 2:74432021-74432043 AGGAAATAAGAAACCACTTAAGG - Intronic
932830659 2:74986551-74986573 ATAAAAAATAAAATGACATATGG - Intergenic
933082401 2:78007080-78007102 ATGAAAAATAAAACCAGAGATGG - Intergenic
933430650 2:82173155-82173177 TTTAAAAAAAAAATCACTTATGG + Intergenic
933581488 2:84131663-84131685 GTGAAAAATAAACCCCCTTTTGG + Intergenic
935019688 2:99217928-99217950 ATTAAAAATAAAATAAGTTAAGG + Intronic
936446865 2:112602895-112602917 ATAAAAAATAACACCACGTCTGG + Intergenic
936691508 2:114895209-114895231 TTGAAAAATAAAACGACGTGTGG + Intronic
937118988 2:119429145-119429167 ATGAAAAATAAACTCACAAAAGG + Intergenic
937530938 2:122826614-122826636 ATGAAAACAAAAAGCACTTTAGG + Intergenic
937838103 2:126494355-126494377 ATGAAGAAAAAAAACCCTTATGG + Intergenic
938167953 2:129048914-129048936 AGGAAAAATAAAATCCTTTACGG - Intergenic
939086778 2:137729142-137729164 ATGAAAAATAAAACCCCTTTGGG - Intergenic
939243004 2:139586279-139586301 AGCAGAAACAAAACCACTTAAGG + Intergenic
939413005 2:141856036-141856058 ATGAAAAGGGAAAGCACTTAAGG - Intronic
939645216 2:144689406-144689428 AAGAAAAAAAAAAAAACTTAGGG + Intergenic
940406254 2:153305790-153305812 ATAAAAAATAAAACCTGTCATGG - Intergenic
940468534 2:154063787-154063809 ATGAAAAATAACAACTTTTATGG + Intronic
940565291 2:155352469-155352491 ATGGAAAGTAAAACCACAGATGG - Intergenic
940569704 2:155415723-155415745 CTTAAATATAAAACCCCTTAAGG + Intergenic
940644943 2:156381388-156381410 ATAAAGTATAAAACCACTAAGGG - Intergenic
940724927 2:157326233-157326255 TTAAAAAATAAAACAGCTTATGG + Intronic
940961033 2:159786237-159786259 ATGATAAATTAAGCTACTTAAGG - Intronic
941308026 2:163894558-163894580 ATGAAAAATAGATCCAATCAGGG + Intergenic
941374646 2:164712262-164712284 ATGGAAAATAAAAACACTCAGGG + Intronic
941873002 2:170405184-170405206 ATATAAAAGAAAACCACTGAGGG - Intronic
942006223 2:171702635-171702657 AGGAAAAAAAAATCCACTTTAGG - Intronic
942332644 2:174843701-174843723 AAAAAAAAAAAACCCACTTAGGG + Intronic
942375409 2:175331482-175331504 ATGAAAAAGAAATCCAATAATGG - Intergenic
942424377 2:175843862-175843884 AACAAAAATAAAAGCACTGATGG - Intergenic
942535149 2:176955586-176955608 AAGAAAAATAAAATCACTGAAGG + Intergenic
943201867 2:184837507-184837529 AGAAAAATTAAAATCACTTATGG + Intronic
943208891 2:184937117-184937139 ATGAAAAATACAACAAAATAAGG + Exonic
943250074 2:185508854-185508876 AGAAAAAATGAAACCACTCAGGG + Intergenic
943500045 2:188676537-188676559 ATCATAATTAAAACCACTTTAGG + Intergenic
943624534 2:190183629-190183651 ATTAAAAATAAAAACACTGGGGG + Intronic
943685840 2:190817208-190817230 ATGAAAATTAAAACCACAGTGGG + Intergenic
944088069 2:195871957-195871979 AAAAAAAAAAAAACTACTTAAGG + Intronic
944102482 2:196043330-196043352 ATGACAAATAAAGTCACATAGGG + Intronic
944454702 2:199880780-199880802 AAGAAAAAAAAAACCTATTATGG - Intergenic
944872346 2:203926660-203926682 ATAAAAAATAAAAACAGTTTTGG - Intergenic
944968569 2:204964899-204964921 CTGAAAAATAGAACCAATTTTGG - Intronic
945206955 2:207342551-207342573 ATGAAAAATAAAAACAAGTTTGG + Intergenic
945448976 2:209971947-209971969 ATGAAAAATTAGAATACTTATGG - Intronic
945477417 2:210301197-210301219 ATTAAAAATCAAACAAATTATGG + Intronic
945508000 2:210665296-210665318 AAGAAAAAAAAAACCACTGATGG - Intronic
945823636 2:214695138-214695160 ATAAAAAAGAAAGCCACTTTTGG + Intergenic
945897094 2:215495947-215495969 ATGAAAAATATGAACATTTAAGG + Intergenic
946669271 2:222085066-222085088 AAGAAAAATAAAACAAGGTAAGG - Intergenic
947009593 2:225551067-225551089 ATGAAAAGTAAGACCCGTTATGG - Intronic
947118217 2:226794040-226794062 ATGCAAAACAAAACAAATTAAGG + Intronic
947126809 2:226877667-226877689 TGGAAAAAGAAAAGCACTTATGG - Intronic
947946160 2:234104222-234104244 ATGAGAAATAAAACGACTATAGG + Intergenic
948313521 2:237008766-237008788 TTTAAAAATTAAAACACTTAGGG - Intergenic
948417058 2:237816287-237816309 ATGAAAACTATAAGCACTTGGGG + Intronic
948823785 2:240564543-240564565 AGGAAAATCTAAACCACTTAAGG + Intronic
1168776872 20:455329-455351 ATTAAAAATAAAACCCCTTCTGG + Intronic
1169006728 20:2213504-2213526 AAGAAACAGAATACCACTTAAGG + Intergenic
1169056023 20:2621673-2621695 ATAAAAAATAAAACCCCTAATGG + Intronic
1169537883 20:6565446-6565468 TTGAAAAATTGAACCAGTTATGG - Intergenic
1169596539 20:7206092-7206114 ATGAAAAATGAAATAACTTTAGG - Intergenic
1169599747 20:7244087-7244109 ATGAACAGAAACACCACTTATGG - Intergenic
1169611751 20:7388821-7388843 AAGACAAATAAAACCACATACGG + Intergenic
1169650649 20:7863495-7863517 ATGAAAATCAAAACCACTATGGG + Intergenic
1169746308 20:8946540-8946562 ATAAAAAATAAAAACACTGTCGG + Intronic
1169974512 20:11309022-11309044 ATGCAAAACAAAACCACAGAAGG + Intergenic
1170178568 20:13501199-13501221 ATGAAATATAAAAATACTAAAGG + Intronic
1170187316 20:13605416-13605438 ATAAATAATAAAATCACTTTTGG + Intronic
1170250770 20:14279434-14279456 AAGAAAAAAAAATCAACTTAAGG - Intronic
1170284934 20:14696511-14696533 CTGAAAAATAAAACAGCTAATGG - Intronic
1172051100 20:32118923-32118945 ATTAAAAATAAATACATTTACGG - Intronic
1173036033 20:39411657-39411679 ATAAAAAATAAAACTTCATATGG - Intergenic
1173075116 20:39811001-39811023 AAGAAAAATAAAACCAATTCTGG - Intergenic
1173357870 20:42312051-42312073 ATGTAAAATGTAACTACTTAAGG - Intronic
1173960384 20:47066807-47066829 ATGAAAAAAACATCCTCTTAAGG - Intronic
1174364381 20:50047610-50047632 AATAAAAAAAAAAGCACTTAAGG - Intergenic
1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG + Intronic
1174937863 20:54892244-54892266 ATGAAAAATACCACCATCTATGG - Intergenic
1175797494 20:61781147-61781169 ATGAAAAATAAACACCCTCAGGG + Intronic
1176347274 21:5760990-5761012 ATGTATAATAAATCCAATTATGG + Intergenic
1176354088 21:5881574-5881596 ATGTATAATAAATCCAATTATGG + Intergenic
1176497553 21:7563465-7563487 ATGTATAATAAATCCAATTATGG - Intergenic
1176521629 21:7829168-7829190 AAGAAAATCAAAACCACTCACGG - Intronic
1176541595 21:8159060-8159082 ATGTATAATAAATCCAATTATGG + Intergenic
1176560546 21:8342105-8342127 ATGTATAATAAATCCAATTATGG + Intergenic
1176740765 21:10599965-10599987 ATGAAAAATAAAAAAAATTGGGG - Intronic
1176948526 21:15014972-15014994 ATTAAAAATAAATCTACTTTGGG - Intronic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1177288761 21:19083330-19083352 AAGTAAAATAAAACCAGTAAGGG - Intergenic
1177480290 21:21677665-21677687 ATTAAAAATAAAAGTACTTAGGG - Intergenic
1177519716 21:22203920-22203942 CTTAACAATAAAACCAGTTAGGG - Intergenic
1177618071 21:23550781-23550803 ATGCAAAATAAAACTACAAATGG - Intergenic
1177946908 21:27481937-27481959 ATATAAAATAAAAACACATAAGG + Intergenic
1178004713 21:28205074-28205096 CAGAAAAATAAAACCACTTTAGG - Intergenic
1178150028 21:29783551-29783573 CTAAAAAATAAAACCATATAAGG - Intronic
1178489436 21:33039591-33039613 AGGATAAATACAACCACTGAGGG - Intergenic
1178564055 21:33666976-33666998 ATGAAAAATAAAAAAACTAGCGG - Intronic
1178604982 21:34028346-34028368 ATGAAAAATAAAATCTCATCAGG - Intergenic
1178655649 21:34459180-34459202 AAGAAAATCAAAACCACTCACGG - Intergenic
1178706642 21:34879863-34879885 AGGAAAAATAAAATCACACATGG + Intronic
1178972297 21:37191276-37191298 TTAAAAATTAAAAGCACTTACGG - Intronic
1179381026 21:40899235-40899257 ATAAAACATAAAGCCATTTATGG + Intergenic
1180603830 22:17040374-17040396 ATAAAAAAGAAAAACACTTTGGG - Intergenic
1180990938 22:19935783-19935805 AGGAAAAAGAAAACCACGTTGGG - Intronic
1183463206 22:37965443-37965465 AAGAAAAATTAAATTACTTAAGG + Intronic
1185113551 22:48918321-48918343 ATCAAAAATAAAAAAAATTAGGG + Intergenic
950666079 3:14495843-14495865 ATGAGATATAAAATAACTTAAGG + Intronic
950723290 3:14899756-14899778 AAGAAAAATAAAGCAAGTTAAGG + Intronic
950907121 3:16549221-16549243 AAGAAAAACAAAACGACCTAAGG + Intergenic
951020381 3:17776168-17776190 CTGAAAGACAAAACCACTCATGG - Intronic
951409957 3:22351192-22351214 ATGGAAAACAAAACCAATTCTGG - Intronic
951486481 3:23217615-23217637 ATCATTAAAAAAACCACTTAAGG - Intronic
951614146 3:24522661-24522683 ATGAAAATTAAAATCACTTCAGG - Intergenic
951922746 3:27874067-27874089 ATGAACATTAGAACCACTTCAGG + Intergenic
952600659 3:35078009-35078031 ATGAAAAATAAAATGATTAATGG + Intergenic
952785280 3:37148338-37148360 AAGGAAAAGAAAAGCACTTAGGG + Intronic
955809777 3:62775352-62775374 TTAAAAAATAAAACCACTTACGG - Intronic
956031420 3:65041909-65041931 AGGAATAATAAGACCTCTTAAGG - Intergenic
956490449 3:69766187-69766209 ATGACAAACAAAACCATTCATGG - Intronic
956815488 3:72904478-72904500 AAGAAAAATAAAACCTCTCCTGG - Intronic
956887100 3:73571210-73571232 AGGAAAAATAAAAGCACTCCAGG - Intronic
957170192 3:76728901-76728923 AATAAAAAAAAAACAACTTATGG - Intronic
957232917 3:77544102-77544124 AAAAAAAAAAAAAACACTTAAGG - Intronic
957263261 3:77927720-77927742 AGAAAAAATAATATCACTTAGGG + Intergenic
957334117 3:78804764-78804786 AGAAAAAAAAAATCCACTTAGGG + Intronic
957453372 3:80409196-80409218 CTGAAAAATAAAAACACAAATGG - Intergenic
958145721 3:89622057-89622079 ATGAACAATAAATCCACATGTGG - Intergenic
958271971 3:91511642-91511664 ATGAATAATATAAACACATATGG + Intergenic
958433448 3:94069365-94069387 ATGAAAAACAAATCAATTTATGG - Intronic
959002100 3:100976404-100976426 AAGAAAAATAAAACTATTTTTGG + Intronic
959247644 3:103895239-103895261 ATGATATATAAAACCACTAATGG + Intergenic
959706468 3:109342768-109342790 TTAAAAAAAAAAACCACTTTGGG + Intergenic
960622457 3:119649932-119649954 CTGAAACATGAAACCACTTCTGG - Intronic
960629959 3:119720085-119720107 ATCAAAAAAAAAAAAACTTAGGG + Intronic
960817341 3:121687503-121687525 ATGGAAAATAAAAATACTTGAGG + Intronic
960819850 3:121717750-121717772 ATGAAAAAGAAACTCACTAAAGG + Intronic
960883885 3:122374828-122374850 ATGAAAAAGAAAACAAACTAAGG + Intronic
961773369 3:129266422-129266444 GTTAAAAAAAAAATCACTTAAGG - Intronic
961964849 3:130892286-130892308 ATTAAAAACAAAAGCACCTAAGG - Intronic
962126018 3:132618864-132618886 TTGAAATTTAAAAACACTTATGG + Intronic
963590739 3:147255134-147255156 ATGAAAAAAATGTCCACTTACGG + Intergenic
963759187 3:149269219-149269241 GAGAAAAAGAAAACCACTCACGG - Intergenic
965049612 3:163628433-163628455 AATAAAAATAAAAGCACTTTTGG - Intergenic
965234854 3:166104632-166104654 CTGAAAAATAAAACACTTTATGG + Intergenic
965553364 3:169993501-169993523 ATGAAAAATAAAAACTATCAAGG - Exonic
966031493 3:175353846-175353868 ATGAAAACTAAAACTACCAAAGG + Intronic
966411644 3:179651988-179652010 AAGAAAAAAAAAAGAACTTAAGG + Intergenic
966631839 3:182084762-182084784 ATGAATAATAAAGCCACTATGGG + Intergenic
967206896 3:187131960-187131982 AAGAAAAATATAACCTCTTGAGG - Intronic
967629137 3:191722307-191722329 ATGAAAACTGAGAACACTTAAGG + Intergenic
968213931 3:196871891-196871913 TTAAAAAATAAAAACCCTTAAGG - Intronic
968324442 3:197800459-197800481 TTGAAAAATAAAACCACAGTGGG + Intronic
969955564 4:10887090-10887112 ATGTTAAATACAACCACTTTTGG + Intergenic
970059739 4:12019045-12019067 ATGAATAACAAAAACAGTTAAGG + Intergenic
970063027 4:12056799-12056821 ATTAAAAATAAAACCAAGAAGGG + Intergenic
970550166 4:17172172-17172194 ATGAAAAAGGCCACCACTTACGG - Intergenic
970960268 4:21863006-21863028 ATGGGAAAAAAAATCACTTAAGG - Intronic
971149792 4:24020059-24020081 ATGAAAAATAAAATCTCTGCAGG + Intergenic
971194538 4:24459454-24459476 ATGAAAAAAAAAAAAACTCAAGG + Intergenic
971797876 4:31252100-31252122 ATGAGAGAAAAACCCACTTATGG - Intergenic
971862057 4:32120778-32120800 AAAAAAAAAAAAACTACTTAGGG - Intergenic
971960571 4:33481225-33481247 ATGAACAATAAAACCAATGCAGG - Intergenic
972078820 4:35123258-35123280 AAGAAAAATATATCAACTTATGG + Intergenic
972949345 4:44299746-44299768 AGGAAAAAAAAAATCACCTAAGG - Intronic
972958352 4:44420143-44420165 AAGAAAAAAAAAACAACTCATGG + Intronic
973032068 4:45358115-45358137 AAGAAAAATACAACCAGATATGG + Intergenic
973035064 4:45396244-45396266 AAGAAAAATGAAACCACACAAGG + Intergenic
973185140 4:47318111-47318133 ATGCAAACTCACACCACTTATGG - Intronic
973586110 4:52393124-52393146 ACCAAAAATAAAACAACCTAAGG - Intergenic
973685124 4:53362100-53362122 ATGACAAATAAAGCCAGGTAAGG + Intronic
973894857 4:55401814-55401836 ATTAAAAATAAAATCAATGAAGG + Intronic
974619037 4:64332036-64332058 AAGAAAAATAAAAAGAATTAGGG + Intronic
975240963 4:72058614-72058636 ATGGAAAATAAGACAACTTCTGG + Intronic
975951261 4:79774511-79774533 CTGAAAAAAAAAACCACAAAAGG + Intergenic
976402532 4:84623670-84623692 GGGAAAAATAAAACTAGTTAAGG - Intronic
976419594 4:84825538-84825560 ATGAAACCTTAAATCACTTAGGG + Intronic
976554981 4:86439961-86439983 AAGAAATATAAAAACATTTAAGG + Intronic
976579668 4:86721492-86721514 AAGAAAAATAAGGCTACTTAAGG + Intronic
977253037 4:94709775-94709797 TTTAAAAAAAAAACCACTAATGG + Intergenic
977428747 4:96903992-96904014 ATGCAAAACAAAACCACTATAGG + Intergenic
977507371 4:97919061-97919083 ATGAAAAATAAAACTACATAGGG + Intronic
978081718 4:104601292-104601314 AAAAAAAATAACAACACTTAAGG - Intergenic
978171639 4:105678301-105678323 ATGAAAAACAAAAACATTTAAGG - Exonic
978430856 4:108631784-108631806 ATGAAAAACAAAATCAATTCAGG + Intergenic
978659170 4:111103050-111103072 ATGAACACTTAAAGCACTTAAGG + Intergenic
978693461 4:111545825-111545847 TTGAAAAATAAAGCCACCTGAGG - Intergenic
978901411 4:113954347-113954369 ATGAAATAGAAAACAACTTCAGG + Intronic
979222387 4:118243079-118243101 ATTAAAAAAAAACCAACTTACGG - Intronic
979311263 4:119206354-119206376 ATGAAAAAAAAAACAAATTGTGG - Intronic
979751102 4:124279805-124279827 AGGGAAAACAAAACCACTCATGG - Intergenic
979843474 4:125476951-125476973 ATGAAAAATAATAATATTTATGG - Intronic
979886926 4:126039814-126039836 ATGAAAAAAAAAAACACATATGG - Intergenic
980015784 4:127648676-127648698 ATGTAAAATGAAACCACTTTTGG - Intronic
980074007 4:128274780-128274802 AGGAAAAATAAAACTAATAAAGG + Intronic
980639761 4:135562023-135562045 ACAAAAAATAAAAATACTTATGG - Intergenic
980649494 4:135693220-135693242 CTTATAAATAAAACCAGTTAGGG + Intergenic
981384121 4:144107514-144107536 ATAAAAAAAAAATCCAATTATGG - Intergenic
981795083 4:148586648-148586670 ATGAAAAATAAAAGGATTTGAGG - Intergenic
981813747 4:148805128-148805150 ATGAAAAATAAAACATCTGTCGG - Intergenic
982312466 4:154000465-154000487 TTGAAAAACAAAACCATCTATGG - Intergenic
982462537 4:155688708-155688730 ACTAAAAATAAAAGGACTTAGGG + Intronic
982628927 4:157806805-157806827 ATGAAAAATAAAATTACCTTTGG + Intergenic
982802801 4:159724884-159724906 ATGTAAAAAAAAACCACTTGTGG - Intergenic
982902616 4:161026271-161026293 TTGAAAAATAAAAGCACTTTTGG + Intergenic
982993031 4:162303327-162303349 ATGTAAAATAAAACTACTTGAGG - Intergenic
983032997 4:162827159-162827181 CTGAAAAATAAAATCAAATAGGG + Intergenic
984435878 4:179709552-179709574 ATGAAAAAAAAAAAAAATTAGGG + Intergenic
984490738 4:180431567-180431589 TTGAGAAATAAAACCAAATATGG + Intergenic
985044585 4:185927738-185927760 TTGACAAATTAAACCACTTAAGG - Intronic
986190709 5:5494193-5494215 ATTAAAAACAAAACCAGCTAGGG - Intergenic
986251667 5:6064390-6064412 AAAAAAAAAAAAAACACTTAGGG + Intergenic
987141155 5:14947697-14947719 ATGAAAAATAAAACAACAAAAGG + Intergenic
987154379 5:15073714-15073736 AAGAAAAACAAAGCCAGTTAGGG + Intergenic
987754264 5:22080490-22080512 ATGCAAAAAAAGACAACTTACGG - Intronic
987877437 5:23696818-23696840 AAGAAAAATAAAACCAACTAGGG - Intergenic
988183838 5:27834723-27834745 ATAGAAAAAGAAACCACTTAAGG - Intergenic
988747573 5:34156551-34156573 ATGAGAAATAAATCTATTTATGG + Intergenic
988816033 5:34836040-34836062 GAGAAAAATAAAACCAGGTAAGG - Intergenic
989016718 5:36943967-36943989 ATGGAGAATAAAAACACATATGG + Intronic
989105135 5:37856125-37856147 ATAAAACATAAAAACACTTTAGG + Intergenic
989128290 5:38078422-38078444 ATAAAAAAAAAAAAAACTTACGG - Intergenic
989689266 5:44120901-44120923 ATGAAAAATACAATCAATTAAGG + Intergenic
989755856 5:44953014-44953036 ATGAAAAAAAAAAAAACTAAAGG - Intergenic
989807781 5:45632044-45632066 ATAAAAAATAAAAGCAATTAAGG - Intronic
990295647 5:54398918-54398940 AAAAAAAATAAAATCACTCAGGG + Intergenic
990484880 5:56248401-56248423 ATAAAAAAAAAATACACTTAAGG + Intergenic
990857904 5:60291689-60291711 ATTAAAAAAAAAACCATGTAAGG + Intronic
991205902 5:64050174-64050196 ATAAAACTTAAAACCACTTATGG + Intergenic
991591301 5:68254410-68254432 ATAAAAAATAAAACCCCCAAAGG + Intronic
992202314 5:74396414-74396436 ATAAAAAATAATAGGACTTATGG - Intergenic
992428672 5:76685757-76685779 ATAAAAAATAAACCCACTGCTGG - Intronic
992815538 5:80433698-80433720 AAGAAAAAAAAAAGCATTTAAGG + Intronic
993028324 5:82672200-82672222 ATGAAAAATAACACGTCCTAAGG - Intergenic
993057252 5:82996035-82996057 ATGTAAAATAACACCATTTTTGG + Intergenic
993357427 5:86931625-86931647 ATGGAAAATAAAATGACTTTTGG + Intergenic
993573465 5:89571427-89571449 ATGAAACATAAATCCTCTGAGGG - Intergenic
993763445 5:91826042-91826064 AAGAAAAATGACACCACCTAGGG + Intergenic
993936459 5:94010810-94010832 AGGAAAATTAAAACAACTAAAGG + Intronic
994144630 5:96380503-96380525 TTGAAAAAGAAAAAGACTTATGG + Intergenic
994255142 5:97584136-97584158 ATGAAAAATATAAATACTTAGGG + Intergenic
994788680 5:104196614-104196636 ATGAAAAATCAAACAAATTAAGG + Intergenic
994912668 5:105932813-105932835 ATGAAAAATGAATGCACTAAGGG + Intergenic
995071771 5:107930709-107930731 ATGAAATATAAAAGAACTTAAGG - Intronic
995098872 5:108273604-108273626 ATGAATAATAAAAGCATTTAGGG - Intronic
995359160 5:111274272-111274294 AAGAAAAATAAAACAAGTTAAGG - Intronic
996141863 5:119921098-119921120 ATGAAAAAAAAAAACGCTTCAGG - Intergenic
996258350 5:121434298-121434320 ATGTAAATTAAAACTACATAAGG - Intergenic
997231544 5:132247889-132247911 ATGAAAAATAAAAATACTTCGGG + Intronic
997965130 5:138350896-138350918 ATGAAAAATAAAATCACACTTGG - Intergenic
998075621 5:139233848-139233870 AAGAAAAATAAAGCCAGGTATGG + Intronic
998736518 5:145147861-145147883 AAGAAAAATAAAAGCACACAAGG + Intergenic
999339903 5:150761477-150761499 ATAAAAATGAAAACCACTTTGGG - Intergenic
999942197 5:156555202-156555224 ATCAAAAATAAAAACACTTCAGG - Intronic
1000743877 5:165005739-165005761 AAATAAAATAAAAACACTTAAGG - Intergenic
1000828928 5:166079823-166079845 ATGAGAAATAATACCACTTGTGG - Intergenic
1001062683 5:168506660-168506682 AAGAAAAAAAAAAAGACTTAAGG - Intronic
1001591925 5:172871479-172871501 AAGAAAAATAAAACAGGTTAAGG - Intronic
1002053828 5:176586949-176586971 ATGAAAAAGAAAACCCCAGAAGG + Intronic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1003460515 6:6323964-6323986 AGGAAAACAAAAACCACTTTAGG + Intergenic
1003534541 6:6965124-6965146 AAAAAAAAAAAAACCAGTTAAGG + Intergenic
1004204345 6:13577378-13577400 ATTAAAGAAAAAACCACTTCAGG - Intronic
1005408043 6:25513277-25513299 ATGACAACTAAAAACACTTCAGG - Intronic
1005473082 6:26181410-26181432 ATGAAAAAAAAAACCTCTGATGG - Intergenic
1005597832 6:27396371-27396393 CAGGGAAATAAAACCACTTATGG - Intronic
1005680181 6:28199042-28199064 ATAACAAATAAAAGCACTTTAGG + Intergenic
1005869600 6:29964847-29964869 ATGGAATAAAAAACCAATTAAGG + Intergenic
1006573393 6:35024388-35024410 ATGAAAGAGAAAACCACAGAAGG + Intronic
1007083649 6:39127335-39127357 ATTAAAAAAAAAACAACTGATGG + Intergenic
1007858342 6:44880843-44880865 AGGAAAAATAAAATCCTTTACGG + Intronic
1007894028 6:45329634-45329656 ATGAAAAATAAAGCTCCATAAGG + Intronic
1008080239 6:47186926-47186948 AAGAAAAATCAAACAAGTTAAGG + Intergenic
1008210382 6:48716012-48716034 ATTAAAAATAAAACTAATTTAGG - Intergenic
1008278506 6:49568261-49568283 ATGATAAATAAAGCAGCTTAAGG + Intergenic
1008387164 6:50904985-50905007 GAGAAAAAGAAAACCACTTTGGG + Intergenic
1008479473 6:51970152-51970174 ATGAAAATTAAAACCACAGTGGG - Intronic
1008683411 6:53898699-53898721 ATGAAAAGTAAAACAACTTCAGG + Intronic
1008784155 6:55145198-55145220 AAGAAAACTAAGACCATTTAGGG - Intronic
1009171198 6:60402361-60402383 ATGAATAATATAAACACATATGG - Intergenic
1009500562 6:64407482-64407504 ATGGAAGATAACACCATTTATGG + Intronic
1010232085 6:73543850-73543872 AAGAAAAATAAAAGAAGTTAAGG + Intergenic
1010577686 6:77552829-77552851 ATAAAACATAAAAACACTTAGGG + Intergenic
1010865282 6:80968826-80968848 AAGAGAAATAAAACTACTTGTGG - Intergenic
1011302920 6:85895197-85895219 AGGAGAAATAAAACCCTTTATGG - Intergenic
1011333884 6:86238572-86238594 AGGAGAAATAAAACCCTTTACGG + Intergenic
1011546782 6:88490374-88490396 TTGGGAAATAAAACCACTTCAGG - Intergenic
1011602099 6:89069512-89069534 ATGAAAAATAAAACCTGGTTGGG + Intergenic
1011800821 6:91013921-91013943 ATGACAAATAAAAGCATTTTGGG - Intergenic
1011922376 6:92595548-92595570 ATTGAAAATATAACCACTTTTGG - Intergenic
1011927357 6:92663215-92663237 ATGAAAAATTAAACAAGTGAAGG + Intergenic
1012179491 6:96133739-96133761 ATGCAAAACAAAAACACTTTAGG - Intronic
1012301211 6:97590911-97590933 ATAAAAAATAAAATCATTTTGGG - Intergenic
1012301554 6:97594783-97594805 ATAAAAAATAATTCCAGTTAGGG + Intergenic
1012457186 6:99420209-99420231 ATGAAAAATGATGCCACTTGAGG - Intronic
1012669444 6:102023526-102023548 GAGAAAAATAAAACCATTTATGG - Intronic
1013216244 6:108029859-108029881 AAGATAAATTAAACCAGTTATGG + Intergenic
1013555656 6:111254593-111254615 ATAAAAAAGGAAACCACTTTAGG - Intergenic
1013581479 6:111539068-111539090 ATGAAAAATAGGAACACTTTTGG - Intergenic
1013736947 6:113239143-113239165 AAGAATAATAAAACCTTTTATGG - Intergenic
1014086320 6:117349598-117349620 ATGAAAAATAATAACAAATATGG - Intronic
1014258509 6:119188489-119188511 ATGAAAAATACTACATCTTACGG - Exonic
1015037944 6:128679977-128679999 ACATAAAATAAATCCACTTAGGG + Intergenic
1015171263 6:130256730-130256752 ATAAAAAATAAAACATTTTATGG + Intronic
1015783216 6:136893182-136893204 AAGAAAAAAAAAGCCACTGAAGG - Intronic
1016050700 6:139527123-139527145 ATGAACAATAAAATAACTTTTGG - Intergenic
1016192104 6:141282100-141282122 AAGAAAAATAAAACCATGGATGG + Intergenic
1016285266 6:142465529-142465551 GTGAAAAAAAAAACCAGTTTTGG + Intergenic
1016379067 6:143454985-143455007 ATGGATAAAAAAATCACTTAGGG + Intronic
1016707590 6:147129787-147129809 ATGAAAAAAAAAAACAGTGAGGG + Intergenic
1016711989 6:147184319-147184341 AGAAAAAAAAAAACCACTTTAGG + Intergenic
1016760770 6:147734166-147734188 ATAAAAACTAAAACCACTTAAGG - Intronic
1016937587 6:149458804-149458826 ATGCAAAATAAAACCACAATAGG - Intronic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017446957 6:154515916-154515938 ATGAAAATTAATACCAATCAGGG + Intergenic
1017695155 6:157007717-157007739 AAAAAAAAAAAAACAACTTAGGG - Intronic
1017975374 6:159352543-159352565 AAGAAAAATAAAACAACACAGGG + Intergenic
1018070080 6:160156733-160156755 ATGAAAAATAAAGCTCCATAGGG - Intronic
1018279658 6:162172085-162172107 ATAAAAAAGAAAACCACCTAAGG + Intronic
1018336939 6:162802481-162802503 ATAAATTATATAACCACTTATGG - Intronic
1018565789 6:165151238-165151260 AAGAAAAATAAAACCAGCAATGG - Intergenic
1018737940 6:166702878-166702900 ACGAAAATTAAAACCACCCACGG + Intronic
1018931737 6:168244358-168244380 ATGAAAAAGAAAACCTCCGATGG - Intergenic
1019007454 6:168812108-168812130 ATGGAAAATAAAACCACTTTTGG + Intergenic
1019157549 6:170049434-170049456 AAGAAACACAAAACCACTGAGGG - Intergenic
1019338768 7:497984-498006 ACAAAAAAAAAAACCACTTAAGG + Intronic
1019377845 7:704988-705010 ATGTAAAATAAAACCACTTTAGG + Intronic
1019829659 7:3314793-3314815 GTTTAAAATAAAACCTCTTAAGG - Intronic
1020353661 7:7253075-7253097 CTGAAAAGTAAAACCAATTAGGG - Intergenic
1020433910 7:8141418-8141440 ATGAAAACTAGAACCAGTCAGGG + Intronic
1020509250 7:9032476-9032498 ATGAAAAACAAAAAAACTTAGGG - Intergenic
1020553619 7:9640641-9640663 AAGAAATATAAAACCACCGATGG - Intergenic
1020698149 7:11442096-11442118 ATGATATATAAACACACTTATGG - Intronic
1020748287 7:12107140-12107162 ATGAAAAAGACATACACTTAAGG + Intergenic
1020908334 7:14094751-14094773 AGAAAAAATAAAGTCACTTAAGG + Intergenic
1020974309 7:14986320-14986342 ATGTCAAATAAAACTCCTTAGGG + Intergenic
1021034171 7:15776264-15776286 AGGAAAAATAAAACAACAAAAGG - Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021284696 7:18766478-18766500 ATGAAAAATAATCCCATTTGGGG - Intronic
1021314433 7:19129358-19129380 ATTAAAAAAAAAACCAATTCTGG - Intergenic
1021676826 7:23088743-23088765 AAGAAAAAAAAAACCATTTGGGG - Intergenic
1022576141 7:31498691-31498713 GTGAACAATAACAGCACTTATGG - Intergenic
1022611910 7:31884285-31884307 TTGAAAAAAAAAATCACTAATGG + Intronic
1022722496 7:32953714-32953736 AAAAAAAAAAAAACAACTTACGG - Intergenic
1022825116 7:34001853-34001875 AATGAAAATAAAAACACTTATGG - Intronic
1022825613 7:34009579-34009601 ATGAAAAATAAATATAATTATGG + Intronic
1022855225 7:34307377-34307399 AAGAAGAATTAAACCAGTTAAGG - Intergenic
1023047335 7:36221967-36221989 ATTAAAAATAAAGCCAGGTAAGG - Intronic
1023068852 7:36407711-36407733 CTGAAACATGAAAACACTTAGGG - Intronic
1023098195 7:36684979-36685001 ATGAAAGATAAAAGCACCTATGG + Intronic
1024406212 7:48984409-48984431 AAGAAAAATAAAACAAAATATGG - Intergenic
1024721721 7:52144309-52144331 TTGAAAAATAAAATCACATCTGG - Intergenic
1025712259 7:63923656-63923678 ATGTAAAATAAAAAGACGTAAGG + Intergenic
1025839807 7:65135606-65135628 ACAAAATATAAAACCATTTACGG + Intergenic
1025883259 7:65560360-65560382 ACAAAATATAAAACCATTTAAGG - Intergenic
1025890187 7:65642247-65642269 ACAAAATATAAAACCATTTACGG + Intergenic
1025924641 7:65947405-65947427 AAAAAAAAAAAAACCAGTTATGG - Intronic
1027184334 7:75961505-75961527 AAGAAAAATAAAGCTTCTTATGG + Intronic
1027585109 7:80047809-80047831 ATGAATAATAAAATCAATTGAGG + Intergenic
1027819043 7:83020183-83020205 ATTAATAATATAAACACTTAGGG - Intronic
1028123942 7:87089735-87089757 CTGAAAAATAAAAACACTGCAGG - Intergenic
1028851411 7:95542401-95542423 ACAAAAAAAAAAACCACTTTTGG - Intergenic
1029855614 7:103513894-103513916 ATGAAAATAAAAATCACTCAGGG - Intronic
1030095759 7:105897994-105898016 TTAAAAAAAAAAACCACATAGGG - Intronic
1030599760 7:111580419-111580441 ATTCAAAATAAAACCACACATGG + Intergenic
1031499457 7:122494873-122494895 ATAAAAAAAAAAAACCCTTATGG - Intronic
1031674063 7:124587674-124587696 AAAAAAAAAAAAACCACTAATGG + Intergenic
1031852296 7:126879743-126879765 ACAAAATATAAAACCATTTAAGG - Intronic
1032244577 7:130198630-130198652 AACAAAAATGAAACCATTTAAGG + Intronic
1032349133 7:131144009-131144031 ATGAAAAACAAAATCAGTTATGG - Intronic
1032421834 7:131786756-131786778 ATGCAGATTAAAACCACTTGAGG - Intergenic
1032951009 7:136912673-136912695 ATCAAAAATAATAGCACTTTAGG - Intronic
1034088720 7:148344463-148344485 ATGAAAAATAAAACAGCATGAGG - Intronic
1034510081 7:151526902-151526924 ATGGAAAACAAAACCAGGTAAGG + Intergenic
1034758653 7:153649460-153649482 AAGAAAAATTAAACCAGATAGGG + Intergenic
1034953218 7:155315456-155315478 ATGAAAAATAAAATGCTTTAGGG + Intergenic
1035392405 7:158513890-158513912 ATGAAAAATTATACAAGTTATGG + Intronic
1036082209 8:5569023-5569045 ATCAAAAATAAAAACAATAAAGG + Intergenic
1036120177 8:6008317-6008339 ATGCACAATAGAATCACTTACGG + Intergenic
1036227603 8:6972714-6972736 ATGCAAAATAAAACCTCAAAGGG + Intergenic
1036230057 8:6991873-6991895 ATGCAAAATAAAACCTCAAAGGG + Intergenic
1036232509 8:7010976-7010998 ATGCAAAATAAAACCTCAAAGGG + Intronic
1036644428 8:10602835-10602857 ATGAACATGAAAACCACCTACGG - Intergenic
1036900133 8:12664262-12664284 ATAAAAAATAAAGCCAGGTATGG - Intergenic
1037003864 8:13752481-13752503 ATGAAAAATAAATCAAGTTCAGG + Intergenic
1037043814 8:14272002-14272024 CTTAAAAATAAAATTACTTAGGG - Intronic
1037114388 8:15206210-15206232 ATGGAAACAAAAACTACTTAGGG + Intronic
1037228891 8:16630000-16630022 TGGAAAACTAAAGCCACTTAGGG - Intergenic
1037445216 8:18958684-18958706 ATGAAAAAGAAAAACCCATATGG + Intronic
1037666885 8:20977504-20977526 CTGAAAAATAGAACCGCTTAGGG + Intergenic
1037720704 8:21441494-21441516 CTCAAAGATAAAACCATTTAAGG - Intergenic
1038137132 8:24798968-24798990 GAGAAAAATAAAAACACATAGGG + Intergenic
1038413798 8:27378367-27378389 ATGAAGAAATAAACCACTTCAGG + Intronic
1038651342 8:29406601-29406623 CTGAAAAATAAAATCCATTAGGG + Intergenic
1038826179 8:31004698-31004720 TTGAAAAATAATCCCATTTAAGG - Intronic
1039286412 8:36046058-36046080 ATGCAAAAAAAAGCCACTGAGGG + Intergenic
1039695331 8:39904495-39904517 GTGAAAAATAAAACAAAGTACGG - Intronic
1040035106 8:42862492-42862514 TTGAAAAATAAATACACTTTAGG + Intronic
1040281062 8:46043878-46043900 ATGAAAAATAATAACAGCTAGGG - Intergenic
1041566020 8:59280096-59280118 CTCAAAAAAAAAACCACGTATGG - Intergenic
1041894950 8:62913671-62913693 ATTAAAGATAAAACTAATTATGG + Intronic
1042054585 8:64750496-64750518 ATGAAAAATAAACCAACAGATGG - Intronic
1042321335 8:67478653-67478675 AAGAAAAGTAAAAACACTTTGGG + Intronic
1042631951 8:70827976-70827998 TTTATAAATAAAACCACTTTGGG + Intergenic
1042695540 8:71550312-71550334 ATAAAAAATAAACCCACCTCTGG - Intronic
1042912383 8:73840863-73840885 AAGAAAAATAAAGCAAATTAAGG + Intronic
1043309619 8:78842329-78842351 AAGAAAAATAAAGCAACATAAGG + Intergenic
1044495391 8:92872592-92872614 AAGAAAAAAAAAATCACTGAAGG + Intergenic
1044515354 8:93131493-93131515 CTGAAAAATAAAACATGTTATGG + Intergenic
1044648681 8:94471384-94471406 AAGAAAAATAAAAACAATAATGG + Intronic
1045254276 8:100506576-100506598 AGGAAAAATAAAACAAGGTAAGG - Intergenic
1045271314 8:100664184-100664206 ATGAAAAATAAAATCAAGTGAGG + Intergenic
1045503279 8:102759441-102759463 AAAAAAAATAAAACAAGTTAGGG - Intergenic
1045524723 8:102931928-102931950 ACAAAAAACAAAACCACTGAGGG - Intronic
1045808184 8:106190482-106190504 ATGAGAACTAAAACTACTTTTGG - Intergenic
1045981272 8:108191079-108191101 ATCAAAGAGCAAACCACTTATGG + Intergenic
1046063316 8:109165546-109165568 AGGAAAATTAAAAACACTTAGGG - Intergenic
1046084750 8:109418226-109418248 ATTAAAAAAAAAAGTACTTAGGG - Intronic
1046123450 8:109874514-109874536 AAGAAAAATAAAAACATTTGGGG + Intergenic
1046182191 8:110665327-110665349 AGGCAAAATAAAATTACTTATGG - Intergenic
1046226908 8:111294072-111294094 TTGAAAAATCAAATCATTTATGG + Intergenic
1047009046 8:120651287-120651309 ATGGAAAATAAAATAACTTTAGG + Intronic
1047363780 8:124193648-124193670 AGAAAATTTAAAACCACTTAGGG - Intergenic
1047425065 8:124737746-124737768 AAGAAATAAAAAACTACTTATGG - Intergenic
1047539741 8:125753151-125753173 AGTCAAAATAAAAGCACTTAAGG - Intergenic
1047905331 8:129467068-129467090 ATAAAAAATAAAATTGCTTAAGG + Intergenic
1047963123 8:130025265-130025287 GGCAAAAAGAAAACCACTTATGG - Intergenic
1048157829 8:131977744-131977766 ATTAAAAATACAACCACACAAGG - Intronic
1048249151 8:132844747-132844769 ATATAAAAGAAAACCACTTAAGG - Intronic
1049873118 8:144996937-144996959 ATGCAAATTAAAACCACATGTGG - Intergenic
1050459458 9:5864974-5864996 ATGGAAAAAAAAATCACTGAAGG + Intergenic
1050564716 9:6870170-6870192 CTGAAAAAAACAACCACTTCAGG + Intronic
1050885867 9:10764009-10764031 ATGAAAAGTAAAATGAGTTAGGG - Intergenic
1051460851 9:17313140-17313162 ATGCAAAATATAACCATTAAAGG - Intronic
1051735756 9:20197727-20197749 ATGAAAAATCACCCCAATTATGG - Intergenic
1051762738 9:20485336-20485358 ATGTAAAATAAAACTATTAACGG - Intronic
1052060614 9:23956210-23956232 AAGAAAAATAAAAAAACTAAAGG - Intergenic
1052220224 9:26012688-26012710 AGCAAAAATAAAATCAGTTAGGG - Intergenic
1052254274 9:26435696-26435718 TTTAAAAATAAAACCATTAATGG + Intergenic
1052491811 9:29179060-29179082 GGCAAAAATTAAACCACTTAGGG + Intergenic
1052617713 9:30863851-30863873 ATGAATAATAAATCCATTTCAGG - Intergenic
1052687205 9:31771662-31771684 AGGAAAAAGAAAACCACATTAGG - Intergenic
1053164618 9:35835581-35835603 ATGTAAAATAAAACCAGTCCTGG - Intronic
1053485886 9:38455920-38455942 ATGAAAGATTATTCCACTTAGGG + Intergenic
1055194754 9:73575634-73575656 AAGAAAAAAAAAAGCACTTCAGG - Intergenic
1055394837 9:75863129-75863151 ATGAAAAATAAGACCTTATAAGG + Intergenic
1055603593 9:77945594-77945616 ATGAAAAATATATCCTCTTAGGG + Intronic
1057362012 9:94382018-94382040 AGGAAAAAAAAAAAAACTTATGG - Intronic
1057475892 9:95401086-95401108 ATGAAAAAAAAAACCCCACAAGG + Intergenic
1057831547 9:98410810-98410832 AAGAAAACAAAAACCACTTCAGG + Intronic
1057916677 9:99061297-99061319 ATGAAAAATAAAAACTCTCTTGG + Intronic
1058268542 9:102938781-102938803 ATTAAAAATCAAACCATTTGAGG - Intergenic
1058481936 9:105404625-105404647 ATGATAAATAAATGAACTTAGGG + Intronic
1058739756 9:107931063-107931085 AGGAACAAGTAAACCACTTAGGG + Intergenic
1059310294 9:113384165-113384187 ATTAAAAATAAAACTAGTGAAGG - Intergenic
1059999907 9:119948898-119948920 AAGAATAATAATACCACGTAGGG + Intergenic
1062134939 9:134921326-134921348 ATGAAAAAAAAATCCACATCAGG + Intergenic
1185935656 X:4254575-4254597 ATAAAAAATAAATTCTCTTAAGG + Intergenic
1186008121 X:5096918-5096940 ATGAAAAACTATAGCACTTAAGG + Intergenic
1186307713 X:8281959-8281981 ATGAATCACAAAACCACTGAGGG - Intergenic
1187242250 X:17523846-17523868 AAGAAAACCAAAACCACTTCGGG - Intronic
1188093492 X:25992365-25992387 GTGAAAAATGAAACAACTTATGG + Intergenic
1188279561 X:28248081-28248103 ATGATAAATATAATCACATATGG - Intergenic
1188355026 X:29180033-29180055 ATGAAAAAAAAATCTACTTTAGG + Intronic
1188844599 X:35057941-35057963 AAGACAAGAAAAACCACTTAAGG - Intergenic
1189112611 X:38308391-38308413 ATTTAAAATAAATGCACTTAAGG - Intronic
1191064514 X:56333506-56333528 AATAAAAATAAAAACACTTCAGG - Intergenic
1191200550 X:57776607-57776629 AGGAAAAAGAAAAACACATAAGG - Intergenic
1192490569 X:71573057-71573079 ATGAAACAGAAAACCACTCAAGG - Intronic
1192598755 X:72439228-72439250 AGGAGAAATAAAATCCCTTATGG + Intronic
1192683221 X:73275589-73275611 ATAAAGAAGAAAACTACTTATGG - Intergenic
1193238650 X:79139886-79139908 AATAAAAATAAAACCACTCCTGG + Intergenic
1193364466 X:80614898-80614920 ACGATAAATAAAAGCAATTAAGG - Intergenic
1193902756 X:87203424-87203446 AAAAAAAAAAAAAACACTTAAGG + Intergenic
1194189052 X:90811940-90811962 ATGAAAAAAAATGCCACCTACGG + Intergenic
1194228430 X:91291568-91291590 GGGATAAATAAAACTACTTATGG - Intergenic
1194498189 X:94644690-94644712 ATGAAACATAAATCTATTTATGG + Intergenic
1194524106 X:94956341-94956363 CTGAAAATTAAAGCCATTTAAGG + Intergenic
1194803239 X:98296978-98297000 AAGAAAAAAAAAATCACTTGGGG + Intergenic
1196132970 X:112177390-112177412 ATGCAAATTAAAACCACTATGGG - Intergenic
1196282296 X:113836115-113836137 ATGCAAAATAAAACTACCTAAGG - Intergenic
1196361440 X:114865593-114865615 ATGCAAATTAAAACCACAAACGG - Intronic
1196593190 X:117512846-117512868 TTAAAAAATGAACCCACTTAGGG + Intergenic
1197226098 X:123958057-123958079 ATGAAAAATGAAATAACTGATGG - Intergenic
1197333660 X:125184868-125184890 ATAAAAATTAAAACCAATGAGGG + Intergenic
1197408039 X:126078449-126078471 ATGACAAATATAAACCCTTAGGG - Intergenic
1197626691 X:128809906-128809928 ATTAAAAATAAAAATACCTAAGG - Intergenic
1197814350 X:130481139-130481161 AAAAAAAAAAAAACCGCTTATGG + Intergenic
1198494234 X:137174604-137174626 ATGAAAAATTAAAACTCTTTAGG + Intergenic
1198504404 X:137287204-137287226 ATGAAAAATCAATCCAGATATGG + Intergenic
1199046590 X:143181341-143181363 GTGAAAAATAACTGCACTTAAGG + Intergenic
1199281940 X:146011578-146011600 AAGAAAAAGAAAACAGCTTATGG + Intergenic
1199395399 X:147331104-147331126 ATGAAACATAAAACAAAATAAGG + Intergenic
1199460616 X:148080468-148080490 ACAAAAAAAAAAACCACTAATGG + Intergenic
1199461262 X:148088129-148088151 ATGGAAAAAAAAACCACAAATGG + Intergenic
1200038527 X:153348782-153348804 CTGTACAATATAACCACTTAAGG + Exonic
1200269894 X:154672772-154672794 ATGAAGAATACAATCACTTGTGG - Intergenic
1200360053 X:155595577-155595599 AAGATAAATAAACCCAGTTAAGG + Intronic
1200535631 Y:4393837-4393859 ATGAAAAAAAATGCCACCTACGG + Intergenic
1200880935 Y:8210679-8210701 CTGAAAGACAAAACCACTCATGG + Intergenic
1201063158 Y:10066394-10066416 ATGAAAAATAAACACTATTAAGG - Intergenic
1201325411 Y:12751363-12751385 ATGTAAATTAAAACCATTAATGG - Intronic
1201546648 Y:15172275-15172297 AAGGAAAAGAAAACCACTAAGGG - Intergenic
1202051478 Y:20785429-20785451 ATGGAAATGAACACCACTTAAGG - Intergenic
1202116207 Y:21470851-21470873 ATGAAAAATAAATACTATTAAGG + Intergenic